WormBase Tree Display for Variation: WBVar00239242
expand all nodes | collapse all nodes | view schema
WBVar00239242 | Name | Public_name | pk204 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | ZK1098.8.1:c.2435G>A | ||||||||
CE00370:p.Trp812Ter | |||||||||
HGVSg | CHROMOSOME_III:g.9539605C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1098 | |||||
Flanking_sequences | ttgatatgaagcatacgattc | accattctataagtaaaaataaattt | |||||||
Mapping_target | ZK1098 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Transposon_insertion | Tc1 | ||||||||
Origin (5) | |||||||||
Affects | Gene | WBGene00003504 | |||||||
Transcript | ZK1098.8.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1098.8.1:c.2435G>A | ||||||||
HGVSp | CE00370:p.Trp812Ter | ||||||||
cDNA_position | 2460 | ||||||||
CDS_position | 2435 | ||||||||
Protein_position | 812 | ||||||||
Exon_number | 8/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.579536 | ||||||
Mapping_data | In_multi_point | 4504 | |||||||
Description | Phenotype (13) | ||||||||
Phenotype_not_observed | WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | ||||||
WBPaper00031961 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Levels of 21U-RNA, from Nothern blot or from qRT-PRC, were comparable to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
21U-RNAs were expressed normally, as determined by Northern blot analysis. | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (15) | |||||||||
Remark | Found by PCR; needs to be confirmed. | ||||||||
Method | Substitution_allele |