WormBase Tree Display for Variation: WBVar00178287
expand all nodes | collapse all nodes | view schema
WBVar00178287 | Name | Public_name | WBVar00178287 | ||
---|---|---|---|---|---|
Other_name | haw45563 | ||||
Sequence_details | Flanking_sequences | TGAAATATCTTTGTTTTCGAGGGAAACCGATTTTTTTTATTTGAAAATGT | CCAAAACAAAGTAAAGTTTAAATGAATTTTAGGGAAAAGGGCACGAAAAT | ||
Mapping_target | M04D8 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | SNP | ||||
Predicted_SNP | |||||
Natural_variant | |||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004602 | ||||
Laboratory | RW | ||||
Person | WBPerson1562 | ||||
Analysis | WGS_Hawaiian_Waterston | ||||
Status | Dead | ||||
Remark | [20081124 db] this Variation was previously named hw45563 | ||||
This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf267870 | |||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
(Re)suppressed because on closer inspection is made invalid by a genome sequence correction | Feature_evidence | WBsf267870 | |||
[Suppressed] This gene was previously annotaed as supressed. | |||||
Method | WGS_Hawaiian_Waterston |