WormBase Tree Display for Variation: WBVar00146744
expand all nodes | collapse all nodes | view schema
WBVar00146744 | Evidence | Paper_evidence | WBPaper00005604 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | h1983 | |||||||
Other_name | CE26338:p.Asp433Asn | ||||||||
ZK177.6.2:c.1297G>A | |||||||||
ZK177.6.1:c.1297G>A | |||||||||
HGVSg | CHROMOSOME_II:g.5503356G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK177 | |||||
Flanking_sequences | cgtccgtactctgaaatgctaacagcttct | acgatggtttcctgcgtatttaccgattca | |||||||
Mapping_target | ZK177 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005604 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | KR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001511 | |||||||
WBGene00305941 | |||||||||
Transcript | ZK177.14 | ||||||||
ZK177.6.2 (12) | |||||||||
ZK177.6.1 (12) | |||||||||
Interactor | WBInteraction000518319 | ||||||||
WBInteraction000524185 | |||||||||
WBInteraction000537487 | |||||||||
Genetics | Interpolated_map_position | II | -1.25733 | ||||||
Description | Phenotype | WBPhenotype:0000318 | Paper_evidence | WBPaper00029006 | |||||
Curator_confirmed | WBPerson49113 | ||||||||
Remark | Table 3, duration of cell cycle (in early embryos) from nuclear envelope breakdown (NEBD) to anaphase, and from NEBD to nuclear envelope reformation (NER), was significantly increased in h1983 mutants compared to unc-46(e177) mdf-1(gk2) controls | Paper_evidence | WBPaper00029006 | ||||||
Curator_confirmed | WBPerson49113 | ||||||||
EQ_annotations | Life_stage | WBls:0000004 | PATO:0000460 | Paper_evidence | WBPaper00029006 | ||||
Curator_confirmed | WBPerson49113 | ||||||||
Phenotype_assay | Genotype | unc-46(e177) mdf-1(gk2) | Paper_evidence | WBPaper00029006 | |||||
Curator_confirmed | WBPerson49113 | ||||||||
WBPhenotype:0000518 | Paper_evidence | WBPaper00037616 | |||||||
Curator_confirmed | WBPerson2784 | ||||||||
Remark | fzy-1(h1983) partially suppresses lethality of mdf-2(tm2190) mutants (Figure 7) | Paper_evidence | WBPaper00037616 | ||||||
Curator_confirmed | WBPerson2784 | ||||||||
Phenotype_assay | Genotype | mdf-2(tm2190) | Paper_evidence | WBPaper00037616 | |||||
Curator_confirmed | WBPerson2784 | ||||||||
WBPhenotype:0000529 | Paper_evidence | WBPaper00037616 | |||||||
Curator_confirmed | WBPerson2784 | ||||||||
Remark | fzy-1(h1983) rescues mdf-2(tm2190) seam cell defects (Table 3) | Paper_evidence | WBPaper00037616 | ||||||
Curator_confirmed | WBPerson2784 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00037616 | ||||
Curator_confirmed | WBPerson2784 | ||||||||
Phenotype_assay | Genotype | mdf-2(tm2190) | Paper_evidence | WBPaper00037616 | |||||
Curator_confirmed | WBPerson2784 | ||||||||
WBPhenotype:0001102 | Paper_evidence | WBPaper00037650 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos exhibit monopolar spindles and undergo monopolar mitosis. | Paper_evidence | WBPaper00037650 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001496 | Paper_evidence | WBPaper00037650 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos exhibit a minor increase in M phase duration upon bipolar spindle assembly. This effect is highlighted in an spd-5(RNAi) background. | Paper_evidence | WBPaper00037650 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00037616 | ||||||||
WBPaper00005604 | |||||||||
WBPaper00037650 | |||||||||
WBPaper00029006 | |||||||||
Method | Substitution_allele |