WormBase Tree Display for Variation: WBVar00146611
expand all nodes | collapse all nodes | view schema
WBVar00146611 | Evidence | Paper_evidence | WBPaper00005216 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | h510 | |||||||
Other_name | B0025.1c.1:c.494G>A | ||||||||
CE37691:p.Trp165Ter | |||||||||
B0025.1a.1:c.506G>A | |||||||||
CE24759:p.Trp169Ter | |||||||||
HGVSg | CHROMOSOME_I:g.6029502G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0025 | |||||
Flanking_sequences | cggatccatttgtaaaacaaccagaaacat | gaaatattctgatgcatggggagatgaaat | |||||||
Mapping_target | B0025 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005216 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | KR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006932 | |||||||
Transcript | B0025.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0025.1c.1:c.494G>A | ||||||||
HGVSp | CE37691:p.Trp165Ter | ||||||||
cDNA_position | 496 | ||||||||
CDS_position | 494 | ||||||||
Protein_position | 165 | ||||||||
Exon_number | 3/7 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0025.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0025.1a.1:c.506G>A | ||||||||
HGVSp | CE24759:p.Trp169Ter | ||||||||
cDNA_position | 508 | ||||||||
CDS_position | 506 | ||||||||
Protein_position | 169 | ||||||||
Exon_number | 3/8 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000557554 | ||||||||
WBInteraction000557555 | |||||||||
WBInteraction000557556 | |||||||||
Genetics | Interpolated_map_position | I | 0.688511 | ||||||
Description | Phenotype | WBPhenotype:0000243 | Paper_evidence | WBPaper00054484 | |||||
Curator_confirmed | WBPerson7492 | ||||||||
Remark | polar body not engulfed by 6-cell stage | Paper_evidence | WBPaper00054484 | ||||||
Curator_confirmed | WBPerson7492 | ||||||||
EQ_annotations | GO_term | GO:0006909 | PATO:0000460 | Paper_evidence | WBPaper00054484 | ||||
Curator_confirmed | WBPerson7492 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00054484 | |||||||
Curator_confirmed | WBPerson7492 | ||||||||
Remark | CED-1 not localized to plasma membrane | Paper_evidence | WBPaper00054484 | ||||||
Curator_confirmed | WBPerson7492 | ||||||||
EQ_annotations | GO_term | GO:0008104 | PATO:0000460 | Paper_evidence | WBPaper00054484 | ||||
Curator_confirmed | WBPerson7492 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00050047 | |||||||
Curator_confirmed | WBPerson7492 | ||||||||
Remark | midbodies not phagocytosed | Paper_evidence | WBPaper00050047 | ||||||
Curator_confirmed | WBPerson7492 | ||||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00050047 | |||||||
Curator_confirmed | WBPerson7492 | ||||||||
Remark | LGG-2 not recruited to the midbody phagosome | Paper_evidence | WBPaper00050047 | ||||||
Curator_confirmed | WBPerson7492 | ||||||||
WBPhenotype:0001864 | Paper_evidence | WBPaper00050047 | |||||||
Curator_confirmed | WBPerson7492 | ||||||||
Remark | CED-1 not transported to plasma membrane | Paper_evidence | WBPaper00050047 | ||||||
Curator_confirmed | WBPerson7492 | ||||||||
Reference | WBPaper00005216 | ||||||||
WBPaper00050047 | |||||||||
WBPaper00054484 | |||||||||
Method | Substitution_allele |