WormBase Tree Display for Variation: WBVar00146150
expand all nodes | collapse all nodes | view schema
WBVar00146150 | Name | Public_name | gk849 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y45G5AM.9b.2:c.357+2067_358-1131delinsGTCTTTATCCC | |||||||
Y45G5AM.9b.1:c.357+2067_358-1131delinsGTCTTTATCCC | ||||||||
Y45G5AM.9a.1:c.357+2067_358-1131delinsGTCTTTATCCC | ||||||||
HGVSg | CHROMOSOME_V:g.4186206_4187949delinsGGGATAAAGAC | |||||||
Sequence_details | SMap | S_parent | Sequence | Y45G5AM | ||||
Flanking_sequences | tcattcttcatgtctcctgtatcatagaca | atctacgtagatcaagccgaaatgagaaac | ||||||
Mapping_target | Y45G5AM | |||||||
Type_of_mutation | Insertion | GGGATAAAGAC | ||||||
Deletion | ||||||||
PCR_product | gk849_external | |||||||
gk849_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00036852 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003704 | ||||||
WBGene00021561 | ||||||||
Transcript | Y45G5AM.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/8 | |||||||
Exon_number | 1-3/9 | |||||||
Y45G5AM.9b.2 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y45G5AM.9b.2:c.357+2067_358-1131delinsGTCTTTATCCC | |||||||
Intron_number | 3/4 | |||||||
Y45G5AM.9b.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y45G5AM.9b.1:c.357+2067_358-1131delinsGTCTTTATCCC | |||||||
Intron_number | 4/5 | |||||||
Y45G5AM.9a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y45G5AM.9a.1:c.357+2067_358-1131delinsGTCTTTATCCC | |||||||
Intron_number | 3/7 | |||||||
Interactor | WBInteraction000534948 | |||||||
WBInteraction000534951 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0001037 | Paper_evidence | WBPaper00042194 | ||||
Curator_confirmed | WBPerson6608 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00048645 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To validate the RNAi approach, we used mutants of three highly similar nuclear hormone receptor (NHR) paralogs, nhr-68, nhr-101, and nhr-114, which have identical regulatory interaction profiles in the GRN (Table S2). We crossed each mutation into reporter strains where GFP expression is driven by the acdh-1 promoter (Pacdh-1::GFP) or the acdh-2 promoter (Pacdh-2::GFP) and observed very similar effects as we did by RNAi - namely, decreased fluorescence of Pacdh-1::GFP and increased fluorescence of Pacdh2::GFP, in the intestine (Figure 2B)." | Paper_evidence | WBPaper00048645 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pacdh-2::GFP | Paper_evidence | WBPaper00048645 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00048645 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To validate the RNAi approach, we used mutants of three highly similar nuclear hormone receptor (NHR) paralogs, nhr-68, nhr-101, and nhr-114, which have identical regulatory interaction profiles in the GRN (Table S2). We crossed each mutation into reporter strains where GFP expression is driven by the acdh-1 promoter (Pacdh-1::GFP) or the acdh-2 promoter (Pacdh-2::GFP) and observed very similar effects as we did by RNAi - namely, decreased fluorescence of Pacdh-1::GFP and increased fluorescence of Pacdh2::GFP, in the intestine (Figure 2B)." | Paper_evidence | WBPaper00048645 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00048645 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00042194 | |||||||
WBPaper00048645 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |