WormBase Tree Display for Variation: WBVar00145781
expand all nodes | collapse all nodes | view schema
| WBVar00145781 | Name | Public_name | gk375 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_X:g.4524114_4524945del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C07A12 | |||||
| Flanking_sequences | cgcgtccttgcccgctcttcccaaactgca | gtgacctcgttttcataatgtgcgaagacg | |||||||
| Mapping_target | C07A12 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | gk375_external | ||||||||
| gk375_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00034930 | ||||||||
| WBStrain00036126 | |||||||||
| Laboratory | VC | ||||||||
| Person | WBPerson427 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003963 | |||||||
| WBGene00219805 | |||||||||
| Transcript | C07A12.4.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| Intron_number | 2-3/6 | ||||||||
| Exon_number | 1-3/7 | ||||||||
| C07A12.19 | VEP_consequence | non_coding_transcript_exon_variant | |||||||
| VEP_impact | MODIFIER | ||||||||
| cDNA_position | 69-? | ||||||||
| Exon_number | 1/1 | ||||||||
| C07A12.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| Intron_number | 2-3/5 | ||||||||
| Exon_number | 1-3/6 | ||||||||
| Isolation | Mutagen | TMP/UV | |||||||
| Description | Phenotype | WBPhenotype:0001013 | Paper_evidence | WBPaper00045520 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Strikingly, the pdi-2 mutant strain displayed hypersensitivity to V. alginolyticus infection resulting in complete death of the nematodes in 11 h which is half the time required for xbp-1 mutant strains and one third of the time required for death in wild type strains." | Paper_evidence | WBPaper00045520 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0042742 | PATO:0000460 | Paper_evidence | WBPaper00045520 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | +/szT1; lon-2(e678) | Paper_evidence | WBPaper00045520 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00045520 | ||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
