WormBase Tree Display for Variation: WBVar00145685
expand all nodes | collapse all nodes | view schema
WBVar00145685 | Name | Public_name | gk278 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_II:g.9323491_9324362del | |||||||
Sequence_details | SMap | S_parent | Sequence | D2013 | ||||
Flanking_sequences | aatttctcgaaaacacctgttttccaaaac | agtttcccgaaagaatcgcaaaatggcagg | ||||||
Mapping_target | D2013 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035887 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006520 | ||||||
Transcript | D2013.10.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-403 | |||||||
CDS_position | ?-403 | |||||||
Protein_position | ?-135 | |||||||
Exon_number | 1/1 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Mapping_data | In_multi_point | 5536 | |||||
Description | Phenotype | WBPhenotype:0000015 | Paper_evidence | WBPaper00058949 | ||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure 5: no chemotaxis to food/HB101 E. coli bacteria | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000023 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure 3: increased paralysis with serotonin and citalopram (SSRI); decreased paralysis with ketanserin (serotonin antagonist) | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
Affected_by | Molecule | WBMol:00004929 | Paper_evidence | WBPaper00058949 | ||||
Curator_confirmed | WBPerson7631 | |||||||
WBMol:00003496 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
WBMol:00003980 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure 2: increased rate of egg laying with preservation of fertility | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure 2: increased brood size | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure 2: decreased median lifespan | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0001437 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure 5: no loss of octanol chemotaxis sensitivity upon starvation (similar to mod-5 mutants) | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
Affected_by | Molecule | WBMol:00007778 | Paper_evidence | WBPaper00058949 | ||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0004028 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure 4: defective enhanced slowing with normal basal slowing response | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
Phenotype_not_observed | WBPhenotype:0000016 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S6 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00058949 | ||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000231 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S2 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000249 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S9 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000303 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S9 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00058949 | ||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000650 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S2 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000747 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S2 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000848 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S2 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0000878 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S5 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S2 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
WBPhenotype:0001331 | Paper_evidence | WBPaper00058949 | ||||||
Curator_confirmed | WBPerson7631 | |||||||
Remark | Figure S5 | Paper_evidence | WBPaper00058949 | |||||
Curator_confirmed | WBPerson7631 | |||||||
Reference | WBPaper00058949 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |