WormBase Tree Display for Variation: WBVar00145405
expand all nodes | collapse all nodes | view schema
| WBVar00145405 | Evidence | Paper_evidence | WBPaper00027609 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ga62 | |||||||
| Other_name | CE34955:p.His329Tyr | ||||||||
| R06B9.6.1:c.985C>T | |||||||||
| HGVSg | CHROMOSOME_II:g.13746999C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | R06B9 | |||||
| Flanking_sequences | ttctcgttttggctcatttttgccggcgag | atctgatcgatgataataccagaaataatt | |||||||
| Mapping_target | R06B9 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027609 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00007433 | ||||||||
| Laboratory | SD | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00305552 | |||||||
| WBGene00003246 | |||||||||
| Transcript | R06B9.7 | ||||||||
| R06B9.6.1 (12) | |||||||||
| Interactor | WBInteraction000001247 | ||||||||
| WBInteraction000504807 | |||||||||
| WBInteraction000521345 | |||||||||
| WBInteraction000524019 | |||||||||
| WBInteraction000524372 | |||||||||
| WBInteraction000524373 | |||||||||
| WBInteraction000535541 | |||||||||
| Genetics | Interpolated_map_position | II | 20.2552 | ||||||
| Description | Phenotype (15) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00031356 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000306 | Paper_evidence | WBPaper00027035 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We first analyzed the expression pattern of lin-39::GFP in bar-1(ga80) and mig-14(ga62) mutants where Wnt signaling is compromised (Eisenmann et al., 1998; Eisenmann and Kim, 2000). In these mutants, we found that GFP levels were upregulated in P6.p, as in wild type animals (data not shown). This is consistent with the phenotypes of bar-1(ga80) and mig-14(ga62), which show a highly penetrant Fused fate phenotype for P3.p and P4.p, but a weaker phenotype for the remaining VPCs where lin-39::GFP expression is robust." | Paper_evidence | WBPaper00027035 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006894 | PATO:0000460 | Paper_evidence | WBPaper00027035 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | lin-39::GFP | Paper_evidence | WBPaper00027035 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000822 | Paper_evidence | WBPaper00036019 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Male gonads do not exhibit any apparent gonadal feminization. | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (11) | |||||||||
| Method | Substitution_allele |
