WormBase Tree Display for Variation: WBVar00145272
expand all nodes | collapse all nodes | view schema
WBVar00145272 | Evidence | Paper_evidence | WBPaper00003865 | ||||
---|---|---|---|---|---|---|---|
Name (2) | |||||||
Sequence_details | SMap | S_parent | Sequence | F15A2 | |||
Flanking_sequences | atttgcccaataaaaaacggggagataatg | cataaatcaagcagtcgggggactgtgtaa | |||||
Mapping_target | F15A2 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00005372 | ||||||
WBStrain00005375 | |||||||
WBStrain00005671 | |||||||
WBStrain00029134 | |||||||
Laboratory | NW | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001164 | |||||
Transcript | F15A2.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-405 | ||||||
CDS_position | ?-392 | ||||||
Protein_position | ?-131 | ||||||
Intron_number | 2-5/7 | ||||||
Exon_number | 1-6/8 | ||||||
Interactor | WBInteraction000503639 | ||||||
WBInteraction000519472 | |||||||
Isolation | Transposon_excision | ||||||
Genetics | Interpolated_map_position | X | 12.62 | ||||
Description | Phenotype | WBPhenotype:0002045 | Paper_evidence | WBPaper00040629 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Germ-cell corpse quantification in mutants show a strong germ-cell death defect, similar to vab-1/EphR-null mutants. | Paper_evidence | WBPaper00040629 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040629 | ||||||
WBPaper00003865 | |||||||
Remark | Flanking sequences are 30 bp to the left of -857 bp from ATG and 30 bp to the right of bp 1008 of F15A2.5 | Curator_confirmed | WBPerson1845 | ||||
ev696 is a deletion of 1865 bp of the genomic region, starting 857 bp upstream of the translation initiation codon and including the codons for the first 132 amino acids of the EFN-3 protein | Paper_evidence | WBPaper00003865 | |||||
[120103 pad] Updated the flanking sequences from [agttcgtaatcaaaattttccttctctctc - ggcacccatgaatttctggtattttcaatt] to [atttgcccaataaaaaacggggagataatg - cataaatcaagcagtcgggggactgtgtaa] as the original placement in 2003 was based on an old CDS annotation. | Person_evidence | WBPerson105 | |||||
WBPerson10100 | |||||||
Curator_confirmed | WBPerson1983 | ||||||
Method | Deletion_allele |