WormBase Tree Display for Variation: WBVar00145223
expand all nodes | collapse all nodes | view schema
WBVar00145223 | Evidence | Paper_evidence | WBPaper00036313 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | et5 | |||||||
Other_name | R13F6.4f.1:c.2962C>T | ||||||||
CE47066:p.Arg1062Ter | |||||||||
CE46882:p.Arg988Ter | |||||||||
R13F6.4e.1:c.3184C>T | |||||||||
R13F6.4d.1:c.2725C>T | |||||||||
CE42908:p.Arg909Ter | |||||||||
R13F6.4a.2:c.2179C>T | |||||||||
R13F6.4a.1:c.2179C>T | |||||||||
CE46838:p.Arg727Ter | |||||||||
HGVSg | CHROMOSOME_III:g.6840916C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | R13F6 | |||||
Flanking_sequences | ggagcacgaagtgtcactcttcaatttctg | gaacacaattccagtctgtcaagaagagcg | |||||||
Mapping_target | R13F6 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00036313 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031159 | ||||||||
Laboratory | QC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006498 | |||||||
Transcript | R13F6.4f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13F6.4f.1:c.2962C>T | ||||||||
HGVSp | CE46882:p.Arg988Ter | ||||||||
cDNA_position | 2962 | ||||||||
CDS_position | 2962 | ||||||||
Protein_position | 988 | ||||||||
Exon_number | 11/17 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
R13F6.4e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13F6.4e.1:c.3184C>T | ||||||||
HGVSp | CE47066:p.Arg1062Ter | ||||||||
cDNA_position | 3184 | ||||||||
CDS_position | 3184 | ||||||||
Protein_position | 1062 | ||||||||
Exon_number | 13/19 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
R13F6.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13F6.4a.1:c.2179C>T | ||||||||
HGVSp | CE46838:p.Arg727Ter | ||||||||
cDNA_position | 2616 | ||||||||
CDS_position | 2179 | ||||||||
Protein_position | 727 | ||||||||
Exon_number | 8/15 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
R13F6.4a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13F6.4a.2:c.2179C>T | ||||||||
HGVSp | CE46838:p.Arg727Ter | ||||||||
cDNA_position | 2796 | ||||||||
CDS_position | 2179 | ||||||||
Protein_position | 727 | ||||||||
Exon_number | 11/18 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
R13F6.4d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13F6.4d.1:c.2725C>T | ||||||||
HGVSp | CE42908:p.Arg909Ter | ||||||||
cDNA_position | 2790 | ||||||||
CDS_position | 2725 | ||||||||
Protein_position | 909 | ||||||||
Exon_number | 11/17 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Genetics | Interpolated_map_position | III | -0.933775 | ||||||
Description | Phenotype | WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 8% of the NSM dorsal processes are missing | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Some NSM neurons send grossly misguided branches | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Some NSM cell bodies are misplaced or misshaped | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031671 | ||||||||
WBPaper00036313 | |||||||||
Method | Substitution_allele |