WormBase Tree Display for Variation: WBVar00145024
expand all nodes | collapse all nodes | view schema
| WBVar00145024 | Evidence | Paper_evidence | WBPaper00028462 | |||
|---|---|---|---|---|---|---|
| Name | Public_name | e2828 | ||||
| Sequence_details | SMap | S_parent | Sequence | T06H11 | ||
| Flanking_sequences | CCCGAATGAAAATTATCACGGAATGAAAATTATCACGGAATGAAAATTTT | AACTCGAAGCTCCAGTTCCACCATCGTGTCCCGAAACGGTGATATGATCA | ||||
| Mapping_target | T06H11 | |||||
| Type_of_mutation | Insertion | TTTTTAGT | Paper_evidence | WBPaper00028462 | ||
| Deletion | ||||||
| SeqStatus | Sequenced | |||||
| Variation_type | Allele | |||||
| Origin | Species | Caenorhabditis elegans | ||||
| Laboratory | CB | |||||
| Status | Live | Curator_confirmed | WBPerson4025 | |||
| Affects | Gene (20) | |||||
| Transcript (27) | ||||||
| Genetics | Interpolated_map_position | X | 1.74993 | |||
| Reference | WBPaper00028462 | |||||
| Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf898329 | |||
| This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | ||||
| Method | Deletion_and_insertion_allele |
