WormBase Tree Display for Variation: WBVar00144937

WBVar00144937 Evidence: Paper_evidence: WBPaper00026735
  Name: Public_name: e2706
    Other_name: CE28024:p.Gly1349Ile
      F39B2.4a.1:c.4039_4040delinsAT
      F39B2.4b.1:c.4045_4046delinsAT
      CE28023:p.Gly1347Ile
    HGVSg: CHROMOSOME_I:g.14779080_14779081delinsAT
  Sequence_details: SMap: S_parent: Sequence: F39B2
    Flanking_sequences: ttgttctacaattgcaaatatttcttcgcc agactttttgaggaatacggcgatcactga
    Mapping_target: F39B2
    Type_of_mutation: Substitution: gg at Paper_evidence: WBPaper00023901
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006349
    Transcript: F39B2.4b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: F39B2.4b.1:c.4045_4046delinsAT
        HGVSp: CE28024:p.Gly1349Ile
        cDNA_position: 4052-4053
        CDS_position: 4045-4046
        Protein_position: 1349
        Exon_number: 16/19
        Codon_change: GGa/ATa
        Amino_acid_change: G/I
      F39B2.4a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: F39B2.4a.1:c.4039_4040delinsAT
        HGVSp: CE28023:p.Gly1347Ile
        cDNA_position: 4047-4048
        CDS_position: 4039-4040
        Protein_position: 1347
        Exon_number: 16/19
        Codon_change: GGa/ATa
        Amino_acid_change: G/I
  Genetics: Interpolated_map_position: I 26.8156
  Description: Phenotype: WBPhenotype:0000006 Paper_evidence: WBPaper00026735
        Curator_confirmed: WBPerson48
        Temperature_sensitive: Cold_sensitive: Paper_evidence: WBPaper00026735
              Curator_confirmed: WBPerson48
      WBPhenotype:0000218 Paper_evidence: WBPaper00026735
        Curator_confirmed: WBPerson48
        Temperature_sensitive: Cold_sensitive: Paper_evidence: WBPaper00026735
              Curator_confirmed: WBPerson48
      WBPhenotype:0000651 Paper_evidence: WBPaper00024311
        Curator_confirmed: WBPerson712
        Remark: Animals become severely constipated compared to wild-type worms, although not to the same extent as ERK MAP kinase cascade mutants, when grown on lawns of M. nematophilum, whereas they are not constipated when grown on standard E. coli food source, OP50. Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: 34% of the animals exhibit severe constipation. Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
      WBPhenotype:0000700 Paper_evidence: WBPaper00024311
        Curator_confirmed: WBPerson712
        Remark: 11% (n=122) of animals display hyperinduction of vulval hypodermal cells. Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 15C Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
      WBPhenotype:0001413 Paper_evidence: WBPaper00026735
          WBPaper00024311
        Curator_confirmed: WBPerson48
          WBPerson712
        Remark: Exhibits poor growth, compared to wild type when grown with M. nematophilum. Paper_evidence: WBPaper00026735
            Curator_confirmed: WBPerson48
          Animals failed to swell when exposed to Microbacterium nematophilum, although bacteria were present in the rectum of these animals. Bacteria were visualized by nucleic acid dye SYTO 13. Paper_evidence: WBPaper00024311
            Curator_confirmed: WBPerson712
        Maternal
        Phenotype_assay: Treatment: Animals were grown on NGM plates seeded with trace (usually 0.01% (v/v)) M. nematophilum in OP50. Strains were cultured on these plates at 25*C. Paper_evidence: WBPaper00024311
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001212 Paper_evidence: WBPaper00026735
        Curator_confirmed: WBPerson48
        Remark: Based on a comparison of bleach sensitivity with wild type worms. Paper_evidence: WBPaper00026735
            Curator_confirmed: WBPerson48
      WBPhenotype:0001411 Paper_evidence: WBPaper00026735
        Curator_confirmed: WBPerson48
        Remark: Based on lectin binding properties to the cuticle Paper_evidence: WBPaper00026735
            Curator_confirmed: WBPerson48
        Phenotype_assay: Treatment: Tested the following fluorescein or rhodamine-conjugated lectins: WGA, SBA, TPA, PEA,, CON, LEA. Paper_evidence: WBPaper00026735
              Curator_confirmed: WBPerson48
      WBPhenotype:0001415 Paper_evidence: WBPaper00026735
        Curator_confirmed: WBPerson48
      WBPhenotype:0001420 Paper_evidence: WBPaper00029153
        Curator_confirmed: WBPerson712
        Remark: No difference was observed between mutant and wild-type in terms of the amount of biofilm accumulated on the nose of the worm. Paper_evidence: WBPaper00029153
            Curator_confirmed: WBPerson712
  Reference: WBPaper00026735
    WBPaper00024311
    WBPaper00029153
  Method: Substitution_allele