WormBase Tree Display for Variation: WBVar00144929

WBVar00144929 Evidence: Paper_evidence: WBPaper00026735
      WBPaper00031667
  Name: Public_name: e2698
    Other_name: CE28488:p.Ala131Val
      T23F2.1b.1:c.434C>T
      T23F2.1a.1:c.392C>T
      CE54583:p.Ala145Val
    HGVSg: CHROMOSOME_X:g.5494256C>T
  Sequence_details: SMap: S_parent: Sequence: T23F2
    Flanking_sequences: cgtctcgatttttcctgtatagatggtatg aaagctcatcggaatcgtcgaagaagaact
    Mapping_target: T23F2
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00031667
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004673
      WBStrain00047800
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00044623
    Transcript: T23F2.1b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: T23F2.1b.1:c.434C>T
        HGVSp: CE54583:p.Ala145Val
        cDNA_position: 434
        CDS_position: 434
        Protein_position: 145
        Exon_number: 4/9
        Codon_change: gCa/gTa
        Amino_acid_change: A/V
      T23F2.1a.1 (12)
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: X -5.24241
  Description: Phenotype (11)
    Phenotype_not_observed: WBPhenotype:0000010 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
        Remark: Animals do not show any enhanced sensitivity to drugs of a variety of sizes and structures. Paper_evidence: WBPaper00031667
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Gravid hermaphrodites were placed into wells (of 96-well plates) containing the compound. Sensitivity was assessed based on the time until paralysis ensued. Concentrations of the compounds are as follows: Nicotine, 0.1%v/v in M9; 1-Phenoxypropan-2-ol , 0.1% or 0.5% in M9; Ivermectin dissolved in DMSO and diluted to 2.5ug/ml in M9. Paper_evidence: WBPaper00031667
              Curator_confirmed: WBPerson712
      WBPhenotype:0000031 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals do not exhibit any major growth retardation, unlike stronger viable alleles of bus-8. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0000050 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
      WBPhenotype:0000054 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 22.5 Paper_evidence: WBPaper00031667
              Curator_confirmed: WBPerson712
      WBPhenotype:0000145 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals were self-fertile (as hermaphrodites) and cross-fertile (as males). Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0001209 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
      WBPhenotype:0001420 Paper_evidence: WBPaper00029153
          WBPaper00031925
        Curator_confirmed: WBPerson712
        Remark: No difference was observed between mutant and wild-type in terms of the amount of biofilm accumulated on the nose of the worm. Paper_evidence: WBPaper00029153
            Curator_confirmed: WBPerson712
          A similar percentage of animals accumulate biofilm produced by Xenorhabdus nematophila on their heads to that of Wild type. Paper_evidence: WBPaper00031925
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Biofilm formation on adult worms was assessed for worms incubated 24-48 hours on the bacterial lawn. Alternatively, gravid adults were allowed to lay eggs on bacterial lawns for several hours, then removed and larvae were assessed for biofilm attachment the next day. Paper_evidence: WBPaper00031925
              Curator_confirmed: WBPerson712
  Reference: WBPaper00031667
    WBPaper00026735
    WBPaper00031925
    WBPaper00029153
    WBPaper00037686
    WBPaper00052991
  Method: Substitution_allele