WormBase Tree Display for Variation: WBVar00144929
expand all nodes | collapse all nodes | view schema
WBVar00144929 | Evidence | Paper_evidence (2) | ||||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2698 | ||||||
Other_name | CE28488:p.Ala131Val | |||||||
T23F2.1b.1:c.434C>T | ||||||||
T23F2.1a.1:c.392C>T | ||||||||
CE54583:p.Ala145Val | ||||||||
HGVSg | CHROMOSOME_X:g.5494256C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T23F2 | ||||
Flanking_sequences | cgtctcgatttttcctgtatagatggtatg | aaagctcatcggaatcgtcgaagaagaact | ||||||
Mapping_target | T23F2 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031667 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004673 | |||||||
WBStrain00047800 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044623 | ||||||
Transcript | T23F2.1b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | T23F2.1b.1:c.434C>T | |||||||
HGVSp | CE54583:p.Ala145Val | |||||||
cDNA_position | 434 | |||||||
CDS_position | 434 | |||||||
Protein_position | 145 | |||||||
Exon_number | 4/9 | |||||||
Codon_change | gCa/gTa | |||||||
Amino_acid_change | A/V | |||||||
T23F2.1a.1 (12) | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | -5.24241 | |||||
Description | Phenotype (11) | |||||||
Phenotype_not_observed | WBPhenotype:0000010 | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not show any enhanced sensitivity to drugs of a variety of sizes and structures. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Gravid hermaphrodites were placed into wells (of 96-well plates) containing the compound. Sensitivity was assessed based on the time until paralysis ensued. Concentrations of the compounds are as follows: Nicotine, 0.1%v/v in M9; 1-Phenoxypropan-2-ol , 0.1% or 0.5% in M9; Ivermectin dissolved in DMSO and diluted to 2.5ug/ml in M9. | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000031 | Paper_evidence | WBPaper00037686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not exhibit any major growth retardation, unlike stronger viable alleles of bus-8. | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 22.5 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000145 | Paper_evidence | WBPaper00037686 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were self-fertile (as hermaphrodites) and cross-fertile (as males). | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001209 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001420 | Paper_evidence (2) | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No difference was observed between mutant and wild-type in terms of the amount of biofilm accumulated on the nose of the worm. | Paper_evidence | WBPaper00029153 | |||||
Curator_confirmed | WBPerson712 | |||||||
A similar percentage of animals accumulate biofilm produced by Xenorhabdus nematophila on their heads to that of Wild type. | Paper_evidence | WBPaper00031925 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Biofilm formation on adult worms was assessed for worms incubated 24-48 hours on the bacterial lawn. Alternatively, gravid adults were allowed to lay eggs on bacterial lawns for several hours, then removed and larvae were assessed for biofilm attachment the next day. | Paper_evidence | WBPaper00031925 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031667 | |||||||
WBPaper00026735 | ||||||||
WBPaper00031925 | ||||||||
WBPaper00029153 | ||||||||
WBPaper00037686 | ||||||||
WBPaper00052991 | ||||||||
Method | Substitution_allele |