WormBase Tree Display for Variation: WBVar00144860

WBVar00144860 Evidence: Paper_evidence: WBPaper00005085
  Name: Public_name: e2510
    Other_name: CE51537:p.Pro264Ser
      R06F6.1.1:c.790C>T
    HGVSg: CHROMOSOME_II:g.10786426C>T
  Sequence_details: SMap: S_parent: Sequence: R06F6
    Flanking_sequences: gatcgcatcaagggacaacatccacgaacc caaataagcttataaacttcagtcgccgca
    Mapping_target: R06F6
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00022736
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00000411
    Transcript: R06F6.1.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: R06F6.1.1:c.790C>T
        HGVSp: CE51537:p.Pro264Ser
        cDNA_position: 807
        CDS_position: 790
        Protein_position: 264
        Exon_number: 5/7
        Codon_change: Cca/Tca
        Amino_acid_change: P/S
    Interactor: WBInteraction000001553
      WBInteraction000001554
      WBInteraction000001555
      WBInteraction000001556
      WBInteraction000001557
      WBInteraction000521672
      WBInteraction000521673
      WBInteraction000521674
  Genetics: Interpolated_map_position: II 3.12582
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: Identified in a screen for zygotic embryonic lethal mutants. Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
      WBPhenotype:0000241 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: While the majority of cell corpses in wild-type embryos disappeared within ~20 minutes, most corpses persisted much longer in cdl-1(e2510) embryos, as long as several hours. Excess cell corpses accumulate at the terminal arrest stage. Terminal embryos contained more than 8 cell corpses, compared to zero in wild-type embryos at the time of hatching. This allele is a neomorph that possesses a function detrimental to embryogenesis only when two copies are present: Df/e2510 embryos showed similar defects in cell death to those of the w37 embryos. Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
      WBPhenotype:0000242 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: Mutants exhibit defects in body elongation. Most e2510 embryos arrested between 1-fold and 1.5-fold. This allele is a neomorph that possesses a function detrimental to embryogenesis only when two copies are present: Df/e2510 embryos showed similar defects in elongation to those of the w37 embryos. Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
      WBPhenotype:0000243 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: While the majority of cell corpses in wild-type embryos disappeared within ~20 minutes, most corpses persisted much longer in cdl-1(e2510) embryos, as long as several hours. Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
      WBPhenotype:0001748 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: Mutants exhibit defects in pharyngeal development. The pharyngeal basement membrane was almost always visible, but the pharynx was never connected with the buccal opening. Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
      WBPhenotype:0002202 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: The pharynx primordium did not move anteriorly throughout embryogenesis in cdl-1 embryos. This defect in pharynx extension was seen in cdl- 1 embryos that elongated to over 3-fold as well as ones arrested at the 1- to 1.5-fold stage. Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
      WBPhenotype:0010003 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: Most cell corpses in cdl-1(e2510) embryos appeared much later than those in the wild type: only ~10 corpses were observed in e2510 embryos between 220 and 470 minutes after first cleavage, during which wild-type embryos generated most cell corpses. Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001185 Paper_evidence: WBPaper00005085
        Curator_confirmed: WBPerson712
        Remark: The rate of cell division was not significantly affected in cdl-1(e2510) embryos, at least in some lineage of the AB decendant (data not shown). Paper_evidence: WBPaper00005085
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00005085
          Curator_confirmed: WBPerson712
  Reference: WBPaper00005085
  Method: Substitution_allele