WormBase Tree Display for Variation: WBVar00144853
expand all nodes | collapse all nodes | view schema
WBVar00144853 | Evidence | Paper_evidence | WBPaper00005085 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e2501 | |||||
Other_name | R06F6.1.1:c.824_825delinsAA | ||||||
CE51537:p.Trp275Ter | |||||||
HGVSg | CHROMOSOME_II:g.10786460_10786461delinsAA | ||||||
Sequence_details | SMap | S_parent | Sequence | R06F6 | |||
Flanking_sequences | ataagcttataaacttcagtcgccgcagtt | gatactcaaatcaagaaatggaagagaagc | |||||
Mapping_target | R06F6 | ||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00005085 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000411 | |||||
Transcript | R06F6.1.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | R06F6.1.1:c.824_825delinsAA | ||||||
HGVSp | CE51537:p.Trp275Ter | ||||||
cDNA_position | 841-842 | ||||||
CDS_position | 824-825 | ||||||
Protein_position | 275 | ||||||
Exon_number | 5/7 | ||||||
Codon_change | tGG/tAA | ||||||
Amino_acid_change | W/* | ||||||
Genetics | Interpolated_map_position | II | 3.12585 | ||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00005085 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Identified in a screen for zygotic embryonic lethal mutants. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Excess cell corpses accumulate at the terminal arrest stage. Terminal embryos contained more than 8 cell corpses, compared to zero in wild-type embryos at the time of hatching. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000242 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants exhibit defects in body elongation. Many embryos reached the pretzel stage and some even hatched, eventually dying as L1 larvae. The elongation process was significantly slower than normal; e2501 embryos did not reach the 3-fold stage until 10 hours, in contrast to the 8.5 hours for wild-type embryos. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001748 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants exhibit defects in pharyngeal development. The pharyngeal basement membrane was almost always visible, but the pharynx was never connected with the buccal opening. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002202 | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The pharynx primordium did not move anteriorly throughout embryogenesis in cdl-1 embryos. This defect in pharynx extension was seen in cdl- 1 embryos that elongated to over 3-fold as well as ones arrested at the 1- to 1.5-fold stage. | Paper_evidence | WBPaper00005085 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00005085 | |||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00005085 | ||||||
Remark | e2501 is either a W260 to opal or W(260) to amber nonsense mutation. | Paper_evidence | WBPaper00005085 | ||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000411 Amber_UAG_or_Opal_UGA W(260) to stop | Paper_evidence | WBPaper00005085 | |||||
Method | Substitution_allele |