WormBase Tree Display for Variation: WBVar00144303
expand all nodes | collapse all nodes | view schema
WBVar00144303 | Evidence | Paper_evidence | WBPaper00027140 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1787 | |||||||
Other_name | Y34D9B.1b.1:c.841C>T | ||||||||
Y34D9B.1a.1:c.829C>T | |||||||||
CE24204:p.Gln281Ter | |||||||||
CE24203:p.Gln277Ter | |||||||||
HGVSg | CHROMOSOME_I:g.949947G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y34D9B | |||||
Flanking_sequences | ttgagccattcaaaaagaattttgaagttc | aaatctcgtgcaccgactacacccatcacc | |||||||
Mapping_target | Y34D9B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027140 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004471 | ||||||||
WBStrain00008499 | |||||||||
WBStrain00008500 | |||||||||
WBStrain00008502 | |||||||||
WBStrain00008506 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003238 | |||||||
Transcript | Y34D9B.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y34D9B.1a.1:c.829C>T | ||||||||
HGVSp | CE24203:p.Gln277Ter | ||||||||
cDNA_position | 883 | ||||||||
CDS_position | 829 | ||||||||
Protein_position | 277 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y34D9B.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y34D9B.1b.1:c.841C>T | ||||||||
HGVSp | CE24204:p.Gln281Ter | ||||||||
cDNA_position | 978 | ||||||||
CDS_position | 841 | ||||||||
Protein_position | 281 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (14) | |||||||||
Genetics | Interpolated_map_position | I | -17.492 | ||||||
Mapping_data | In_multi_point | 1241 | |||||||
3434 | |||||||||
3435 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 20 | 20 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000070 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit defects in the formation of the hook and in the organization of the spicules. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000120 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | QL daughters showed decrease MAB-5 antibody staining. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 95% | Paper_evidence | WBPaper00002582 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000199 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male tails have few rays, rays that are present have abnormal morphology; unlike mab-5 mutants, these rays are not replaced with alae (data not shown). | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Spicules were often crumpled. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000393 | Paper_evidence | WBPaper00065184 | |||||||
Curator_confirmed | WBPerson41726 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00003383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | mig-1(e1787) results in a loss of mab-5 expression in 72% of QL neuroblasts, as determined by anti-MAB-5 antibody staining (Table 1). | Paper_evidence | WBPaper00003383 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00003383 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00003383 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00002582 | |||||||
WBPaper00003383 | |||||||||
WBPaper00024898 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Although the migration of QL is posterior, QL descendants reverse direction during migration and migrate anteriorly. The final position of QL.pa daughters were displaced anteriorly compared to controls. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
abnormal migration of Q neuroblasts (both QL and QR migrate anteriorly) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
mig-1(e1787) results in only 15% of descendants of the QL neuroblast in the posterior of the animal, where the cell migrates in wild type (Table 1). | Paper_evidence | WBPaper00003383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 1 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 58 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
High | 95% | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00003383 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00003383 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because QL descendants sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p and misplaced posteriorly if its nucleus was posterior to V5.p. Because they occupy positions near each other, the data for SDQL and PVM were combined." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00001105 | |||||||
WBPaper00024898 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | HSNs fail to arrive at their final destination (between P5/6 and V4) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
HSN migration abnormal | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
"Mutations in mig-1 and lin-17 disrupt HSN cell migration, although the effects of lin-17 mutations are weak (Figure 4; Desai et al. 1988; Hedgecock et al. 1987; Harris et al. 1996)." (Table 1) | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 63 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
WBPaper00024898 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because the HSNs were sometimes misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. An HSN was scored as misplaced anteriorly if its nucleus was anterior to the P5/6 nucleus and as misplaced posteriorly if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00065184 | |||||||
Curator_confirmed | WBPerson41726 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00040245 | |||||||
Curator_confirmed | WBPerson10153 | ||||||||
Remark | migration defects and dendrite development defects in the PQR neuron | Paper_evidence | WBPaper00040245 | ||||||
Curator_confirmed | WBPerson10153 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00040245 | ||||
Curator_confirmed | WBPerson10153 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | mig-1(e1787) mutants exhibit a nearly complete loss of expression of the mab-5::GFP transgene in QL descendants (Table 2) | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | muIs16 [mab-5::GFP] | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001798 | Paper_evidence | WBPaper00044349 | |||||||
Curator_confirmed | WBPerson3718 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00044349 | ||||||
Curator_confirmed | WBPerson3718 | ||||||||
Recessive | Paper_evidence | WBPaper00044349 | |||||||
Curator_confirmed | WBPerson3718 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00044349 | ||||||
Curator_confirmed | WBPerson3718 | ||||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00061837 | |||||||
Curator_confirmed | WBPerson1068 | ||||||||
Phenotype_not_observed (12) | |||||||||
Reference (16) | |||||||||
Method | Substitution_allele |