WormBase Tree Display for Variation: WBVar00144303
expand all nodes | collapse all nodes | view schema
WBVar00144303 | Evidence | Paper_evidence | WBPaper00027140 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1787 | |||||||
Other_name | Y34D9B.1b.1:c.841C>T | ||||||||
Y34D9B.1a.1:c.829C>T | |||||||||
CE24204:p.Gln281Ter | |||||||||
CE24203:p.Gln277Ter | |||||||||
HGVSg | CHROMOSOME_I:g.949947G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y34D9B | |||||
Flanking_sequences | ttgagccattcaaaaagaattttgaagttc | aaatctcgtgcaccgactacacccatcacc | |||||||
Mapping_target | Y34D9B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027140 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004471 | ||||||||
WBStrain00008499 | |||||||||
WBStrain00008500 | |||||||||
WBStrain00008502 | |||||||||
WBStrain00008506 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003238 | |||||||
Transcript | Y34D9B.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y34D9B.1a.1:c.829C>T | ||||||||
HGVSp | CE24203:p.Gln277Ter | ||||||||
cDNA_position | 883 | ||||||||
CDS_position | 829 | ||||||||
Protein_position | 277 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y34D9B.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y34D9B.1b.1:c.841C>T | ||||||||
HGVSp | CE24204:p.Gln281Ter | ||||||||
cDNA_position | 978 | ||||||||
CDS_position | 841 | ||||||||
Protein_position | 281 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000000780 | ||||||||
WBInteraction000500064 | |||||||||
WBInteraction000500065 | |||||||||
WBInteraction000500486 | |||||||||
WBInteraction000500490 | |||||||||
WBInteraction000500491 | |||||||||
WBInteraction000524025 | |||||||||
WBInteraction000524200 | |||||||||
WBInteraction000524382 | |||||||||
WBInteraction000538637 | |||||||||
WBInteraction000538646 | |||||||||
WBInteraction000538651 | |||||||||
WBInteraction000538655 | |||||||||
WBInteraction000538662 | |||||||||
Genetics | Interpolated_map_position | I | -17.492 | ||||||
Mapping_data | In_multi_point | 1241 | |||||||
3434 | |||||||||
3435 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 20 | 20 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000070 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit defects in the formation of the hook and in the organization of the spicules. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000120 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | QL daughters showed decrease MAB-5 antibody staining. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 95% | Paper_evidence | WBPaper00002582 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000199 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male tails have few rays, rays that are present have abnormal morphology; unlike mab-5 mutants, these rays are not replaced with alae (data not shown). | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Spicules were often crumpled. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000393 | Paper_evidence | WBPaper00065184 | |||||||
Curator_confirmed | WBPerson41726 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00003383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | mig-1(e1787) results in a loss of mab-5 expression in 72% of QL neuroblasts, as determined by anti-MAB-5 antibody staining (Table 1). | Paper_evidence | WBPaper00003383 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00003383 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00003383 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00002582 | |||||||
WBPaper00003383 | |||||||||
WBPaper00024898 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Although the migration of QL is posterior, QL descendants reverse direction during migration and migrate anteriorly. The final position of QL.pa daughters were displaced anteriorly compared to controls. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
abnormal migration of Q neuroblasts (both QL and QR migrate anteriorly) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
mig-1(e1787) results in only 15% of descendants of the QL neuroblast in the posterior of the animal, where the cell migrates in wild type (Table 1). | Paper_evidence | WBPaper00003383 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 1 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 58 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
High | 95% | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00003383 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00003383 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because QL descendants sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p and misplaced posteriorly if its nucleus was posterior to V5.p. Because they occupy positions near each other, the data for SDQL and PVM were combined." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00001105 | |||||||
WBPaper00024898 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | HSNs fail to arrive at their final destination (between P5/6 and V4) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
HSN migration abnormal | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
"Mutations in mig-1 and lin-17 disrupt HSN cell migration, although the effects of lin-17 mutations are weak (Figure 4; Desai et al. 1988; Hedgecock et al. 1987; Harris et al. 1996)." (Table 1) | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 63 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
WBPaper00024898 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because the HSNs were sometimes misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. An HSN was scored as misplaced anteriorly if its nucleus was anterior to the P5/6 nucleus and as misplaced posteriorly if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00065184 | |||||||
Curator_confirmed | WBPerson41726 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00040245 | |||||||
Curator_confirmed | WBPerson10153 | ||||||||
Remark | migration defects and dendrite development defects in the PQR neuron | Paper_evidence | WBPaper00040245 | ||||||
Curator_confirmed | WBPerson10153 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00040245 | ||||
Curator_confirmed | WBPerson10153 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | mig-1(e1787) mutants exhibit a nearly complete loss of expression of the mab-5::GFP transgene in QL descendants (Table 2) | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | muIs16 [mab-5::GFP] | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001798 | Paper_evidence | WBPaper00044349 | |||||||
Curator_confirmed | WBPerson3718 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00044349 | ||||||
Curator_confirmed | WBPerson3718 | ||||||||
Recessive | Paper_evidence | WBPaper00044349 | |||||||
Curator_confirmed | WBPerson3718 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00044349 | ||||||
Curator_confirmed | WBPerson3718 | ||||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00061837 | |||||||
Curator_confirmed | WBPerson1068 | ||||||||
Phenotype_not_observed | WBPhenotype:0000070 | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No defects were reported in the morphology of the male tail hook and rays 1-6. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The mig-1(e1787) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000232 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "A CAN was scored as defective if its nucleus was anterior to the V3 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No axon guidance defects in SIA/SIB/SMD neurons | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because they occupy positions near each other, the data for SDQR and AVM were combined and are presented in the QR column. SDQR and AVM were scored as defective if their nuclei were posterior to the V2.a nucleus. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From the Table 1 legend: "An ALM was scored as defective if its nucleus was anterior to the V2 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because BDUs sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A BDU was scored as misplaced anteriorly if its nucleus was anterior to its normal position immediately anterior to V1 and misplaced posteriorly if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000852 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Coelomocytes were produced. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Nerve ring development is normal | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001235 | Paper_evidence | WBPaper00004436 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Animals exhibited wild type V5 cell division polarity (Table 2) | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004876 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004250 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007446 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004246 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007463 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00040245 | ||||||||
WBPaper00024898 | |||||||||
WBPaper00003383 | |||||||||
WBPaper00004436 | |||||||||
WBPaper00032446 | |||||||||
WBPaper00035405 | |||||||||
WBPaper00001105 | |||||||||
WBPaper00002582 | |||||||||
WBPaper00014212 | |||||||||
WBPaper00018943 | |||||||||
WBPaper00022891 | |||||||||
WBPaper00044349 | |||||||||
WBPaper00044679 | |||||||||
WBPaper00060654 | |||||||||
WBPaper00061837 | |||||||||
WBPaper00065184 | |||||||||
Method | Substitution_allele |