WormBase Tree Display for Variation: WBVar00144066
expand all nodes | collapse all nodes | view schema
| WBVar00144066 | Evidence | Paper_evidence | WBPaper00002482 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1515 | |||||
| Other_name | F16F9.5.1:c.314C>T | ||||||
| CE09444:p.Ser105Phe | |||||||
| HGVSg | CHROMOSOME_X:g.8469880G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | T01B10 | |||
| Flanking_sequences | ggcatttacaacagttttgctataaaacat | tagtcatggtattccaatgcttgggcaagc | |||||
| Mapping_target | T01B10 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002482 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004352 | ||||||
| WBStrain00004462 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003174 | |||||
| Transcript | F16F9.5.1 | VEP_consequence | missense_variant | ||||
| VEP_impact | MODERATE | ||||||
| HGVSc | F16F9.5.1:c.314C>T | ||||||
| HGVSp | CE09444:p.Ser105Phe | ||||||
| cDNA_position | 388 | ||||||
| CDS_position | 314 | ||||||
| Protein_position | 105 | ||||||
| Exon_number | 3/19 | ||||||
| Codon_change | tCt/tTt | ||||||
| Amino_acid_change | S/F | ||||||
| Genetics | Interpolated_map_position | X | 0.0292771 | ||||
| Mapping_data | In_multi_point | 423 | |||||
| 424 | |||||||
| In_pos_neg_data | 2232 | ||||||
| Description | Phenotype (25) | ||||||
| Phenotype_not_observed | WBPhenotype:0000397 | Paper_evidence | WBPaper00061677 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | mec-10 has a normal response to harsh touch | Paper_evidence | WBPaper00061677 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000412 | Paper_evidence | WBPaper00003408 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00040149 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | The distribution of the mechanoreceptor channels along the process of PLM touch receptor neurons is essentially unchanged in mec-10 mutants as assayed by the localization pattern of MEC-4::YFP and anti-MEC-2 antibody staining. | Paper_evidence | WBPaper00040149 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00031965 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals showed no differences in movement on agar compared to wild-type animals. | Paper_evidence | WBPaper00031965 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000663 | Paper_evidence | WBPaper00003408 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0000738 | Paper_evidence | WBPaper00061677 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Of these mutants, only mec-3 showed a significantly lower precipice response frequency than N2 (Figure 1B,C). | Paper_evidence | WBPaper00061677 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001221 | Paper_evidence | WBPaper00003408 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0001700 | Paper_evidence | WBPaper00031965 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals showed no differences in movement in bulk fluids compared to wild-type animals. | Paper_evidence | WBPaper00031965 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00040149 | ||||||
| WBPaper00043908 | |||||||
| WBPaper00000502 | |||||||
| WBPaper00031965 | |||||||
| WBPaper00049074 | |||||||
| WBPaper00003408 | |||||||
| WBPaper00030928 | |||||||
| WBPaper00061677 | |||||||
| WBPaper00065340 | |||||||
| Method | Substitution_allele |
