WormBase Tree Display for Variation: WBVar00144066
expand all nodes | collapse all nodes | view schema
WBVar00144066 | Evidence | Paper_evidence | WBPaper00002482 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1515 | |||||||
Other_name | F16F9.5.1:c.314C>T | ||||||||
CE09444:p.Ser105Phe | |||||||||
HGVSg | CHROMOSOME_X:g.8469880G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01B10 | |||||
Flanking_sequences | ggcatttacaacagttttgctataaaacat | tagtcatggtattccaatgcttgggcaagc | |||||||
Mapping_target | T01B10 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002482 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004352 | ||||||||
WBStrain00004462 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003174 | |||||||
Transcript | F16F9.5.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F16F9.5.1:c.314C>T | ||||||||
HGVSp | CE09444:p.Ser105Phe | ||||||||
cDNA_position | 388 | ||||||||
CDS_position | 314 | ||||||||
Protein_position | 105 | ||||||||
Exon_number | 3/19 | ||||||||
Codon_change | tCt/tTt | ||||||||
Amino_acid_change | S/F | ||||||||
Genetics | Interpolated_map_position | X | 0.0292771 | ||||||
Mapping_data | In_multi_point | 423 | |||||||
424 | |||||||||
In_pos_neg_data | 2232 | ||||||||
Description | Phenotype | WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000353 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000398 | Paper_evidence | WBPaper00031965 | |||||||
WBPaper00061677 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals fail to respond to light touch applied manually with an eyelash. | Paper_evidence | WBPaper00031965 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
mec-10 has a roughly 70% reduction in gentle touch response | Paper_evidence | WBPaper00061677 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||||||
WBPaper00040149 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | On average, mec-10 mutant animals respond only to 1-4 touches of 10, whereas wild-type animals respond to 9 touches of 10. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
touch insensitive | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000542 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lethargic | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00030928 | |||||||
Curator_confirmed | WBPerson48778 | ||||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||||
Curator_confirmed | WBPerson48778 | ||||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00049074 | |||||||
Curator_confirmed | WBPerson6118 | ||||||||
Remark | enhanced reversing rate off food and reduced reversing rate on food compared to N2 | Paper_evidence | WBPaper00049074 | ||||||
Curator_confirmed | WBPerson6118 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00049074 | |||||
Curator_confirmed | WBPerson6118 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001773 | Paper_evidence | WBPaper00031965 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not show an increased speed when placed in liquid-filled, microfluidic chambers containing a square array of posts. Animals moved much more slowly compared to wild type in these chambers and failed to sustain the enhanced swimming pattern exhibited by wild-type animals. | Paper_evidence | WBPaper00031965 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002028 | Paper_evidence | WBPaper00040149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have MRCs with a dramatic reduction in peak MRC size compared to wild-type. Touch receptor neuron respond to applied pressure stimulus. Latency for MRC off response are extended compared to wild type. Mutations in MEC-10 shifted the reversal potential for MRCs by -40 mV or more. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00040149 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002291 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002299 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002310 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002324 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002336 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002347 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002592 | Paper_evidence | WBPaper00030928 | |||||||
Curator_confirmed | WBPerson48778 | ||||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||||
Curator_confirmed | WBPerson48778 | ||||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000397 | Paper_evidence | WBPaper00061677 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mec-10 has a normal response to harsh touch | Paper_evidence | WBPaper00061677 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The distribution of the mechanoreceptor channels along the process of PLM touch receptor neurons is essentially unchanged in mec-10 mutants as assayed by the localization pattern of MEC-4::YFP and anti-MEC-2 antibody staining. | Paper_evidence | WBPaper00040149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031965 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed no differences in movement on agar compared to wild-type animals. | Paper_evidence | WBPaper00031965 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000738 | Paper_evidence | WBPaper00061677 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Of these mutants, only mec-3 showed a significantly lower precipice response frequency than N2 (Figure 1B,C). | Paper_evidence | WBPaper00061677 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00031965 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed no differences in movement in bulk fluids compared to wild-type animals. | Paper_evidence | WBPaper00031965 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040149 | ||||||||
WBPaper00043908 | |||||||||
WBPaper00000502 | |||||||||
WBPaper00031965 | |||||||||
WBPaper00049074 | |||||||||
WBPaper00003408 | |||||||||
WBPaper00030928 | |||||||||
WBPaper00061677 | |||||||||
WBPaper00065340 | |||||||||
Method | Substitution_allele |