WormBase Tree Display for Variation: WBVar00144046
expand all nodes | collapse all nodes | view schema
WBVar00144046 | Evidence | Paper_evidence | WBPaper00001793 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1498 | |||||||
Other_name | CE42646:p.Gln106Ter | ||||||||
F01D4.6a.1:c.445C>T | |||||||||
CE27422:p.Gln149Ter | |||||||||
F01D4.6c.1:c.316C>T | |||||||||
CE52302:p.Gln132Ter | |||||||||
F01D4.6d.1:c.394C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.10460435G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F01D4 | |||||
Flanking_sequences | accgtatcctgtatgtcacattatcctcct | aaatggatgacaacgcacctggagcaatag | |||||||
Mapping_target | F01D4 | ||||||||
Type_of_mutation | Substitution | C | T | Paper_evidence | WBPaper00001793 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Linked_to | WBVar01473870 | ||||||||
Affects | Gene | WBGene00003167 | |||||||
Transcript | F01D4.6d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01D4.6d.1:c.394C>T | ||||||||
HGVSp | CE52302:p.Gln132Ter | ||||||||
cDNA_position | 491 | ||||||||
CDS_position | 394 | ||||||||
Protein_position | 132 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F01D4.6c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01D4.6c.1:c.316C>T | ||||||||
HGVSp | CE42646:p.Gln106Ter | ||||||||
cDNA_position | 316 | ||||||||
CDS_position | 316 | ||||||||
Protein_position | 106 | ||||||||
Exon_number | 3/6 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F01D4.6a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01D4.6a.1:c.445C>T | ||||||||
HGVSp | CE27422:p.Gln149Ter | ||||||||
cDNA_position | 546 | ||||||||
CDS_position | 445 | ||||||||
Protein_position | 149 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | IV | 4.59788 | ||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000816 | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mechanosensory cells remain small and do not have processes. | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ALM cells more lateral than in WT | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00000502 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000502 | ||||||||
WBPaper00001793 | |||||||||
WBPaper00010529 | |||||||||
Method | Substitution_allele |