WormBase Tree Display for Variation: WBVar00144002
expand all nodes | collapse all nodes | view schema
WBVar00144002 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e1431 | |||
Other_name | C09G5.2a.1:c.797+2947C>T | ||||
C09G5.6.1:c.145-1G>A | |||||
HGVSg | CHROMOSOME_II:g.10709203G>A | ||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | |
Flanking_sequences | agacataattgaaattattttaaaattata | gatatcgcaaacaatatctgggaagaaatg | |||
Mapping_target | C09G5 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051517 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00007488 | |||
WBGene00000251 | |||||
Transcript | C09G5.2a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | C09G5.2a.1:c.797+2947C>T | ||||
Intron_number | 6/10 | ||||
C09G5.6.1 | VEP_consequence | splice_acceptor_variant | |||
VEP_impact | HIGH | ||||
HGVSc | C09G5.6.1:c.145-1G>A | ||||
Intron_number | 2/6 | ||||
Genetics | Interpolated_map_position | II | 3.1241 | ||
Remark | alt_det = g to a mut_det = ag -> aa | Person_evidence | WBPerson10095 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson10095 on 2022-02-17_15:07:00 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |