WormBase Tree Display for Variation: WBVar00143985
expand all nodes | collapse all nodes | view schema
WBVar00143985 | Evidence | Paper_evidence | WBPaper00003628 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1410 | |||||||
Other_name | CE27761:p.Gln104Ter | ||||||||
CE28236:p.Gln104Ter | |||||||||
F54B11.3b.1:c.310C>T | |||||||||
F54B11.3a.1:c.310C>T | |||||||||
HGVSg | CHROMOSOME_X:g.13585583C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F54B11 | |||||
Flanking_sequences | ggtggtactacttcaggatcactctctgag | aggagcactggtcagcggccagtctcagca | |||||||
Mapping_target | F54B11 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003628 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006816 | |||||||
Transcript | F54B11.3a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F54B11.3a.1:c.310C>T | ||||||||
HGVSp | CE28236:p.Gln104Ter | ||||||||
cDNA_position | 315 | ||||||||
CDS_position | 310 | ||||||||
Protein_position | 104 | ||||||||
Exon_number | 3/12 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
F54B11.3b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F54B11.3b.1:c.310C>T | ||||||||
HGVSp | CE27761:p.Gln104Ter | ||||||||
cDNA_position | 315 | ||||||||
CDS_position | 310 | ||||||||
Protein_position | 104 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | X | 13.7262 | ||||||
Mapping_data | In_2_point | 6104 | |||||||
6162 | |||||||||
In_multi_point | 179 | ||||||||
180 | |||||||||
793 | |||||||||
1197 | |||||||||
1369 | |||||||||
2411 | |||||||||
2417 | |||||||||
In_pos_neg_data (14) | |||||||||
Description | Phenotype | WBPhenotype:0000099 | Paper_evidence | WBPaper00039986 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | P neuroblast daughters were missing. | Paper_evidence | WBPaper00039986 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008590 | PATO:0000460 | Paper_evidence | WBPaper00039986 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000511 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | variable failures in nuclear migrations : same phenotypes as unc-83(e1408). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000512 | Paper_evidence | WBPaper00039986 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit reduced numbers of nuclei in the ventral nerve cord. | Paper_evidence | WBPaper00039986 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000544 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | reverse kinker as adult, L1 moves well; variable failures in nuclear migrations : same phenotypes as unc-83(e1408). ES3 ME3 (15C) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mating always successful (ME3) at 15C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001152 | Paper_evidence | WBPaper00039986 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00039986 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001998 | Paper_evidence | WBPaper00038282 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a similar pattern of vulval cell fate frequency to that of osm-11(ok810) animals with a laser isolated Pn.p cell, that among animals with only one Pn.p animals showed an increase in primary cell fates. | Paper_evidence | WBPaper00038282 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038282 | ||||||||
WBPaper00039986 | |||||||||
WBPaper00003628 | |||||||||
WBPaper00016044 | |||||||||
WBPaper00017147 | |||||||||
WBPaper00015175 | |||||||||
Method | Substitution_allele |