WormBase Tree Display for Variation: WBVar00143964
expand all nodes | collapse all nodes | view schema
| WBVar00143964 | Evidence | Paper_evidence | WBPaper00027360 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1387 | |||||||
| Other_name | CE40504:p.Gln892Ter | ||||||||
| F23B2.4.1:c.2674C>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.9138243G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F23B2 | |||||
| Flanking_sequences | cttctgagtcagcaatatttggatcgaagc | aaactgaagagaacttgacacttctgaata | |||||||
| Mapping_target | F23B2 | ||||||||
| Type_of_mutation | Substitution | c | t | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004318 | ||||||||
| WBStrain00006213 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000906 | |||||||
| Transcript | F23B2.4.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F23B2.4.1:c.2674C>T | ||||||||
| HGVSp | CE40504:p.Gln892Ter | ||||||||
| cDNA_position | 2689 | ||||||||
| CDS_position | 2674 | ||||||||
| Protein_position | 892 | ||||||||
| Exon_number | 16/21 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Genetics | Interpolated_map_position | IV | 4.05367 | ||||||
| Mapping_data | In_2_point | 429 | |||||||
| 430 | |||||||||
| In_multi_point | 3239 | ||||||||
| Description | Phenotype (22) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000398 | Paper_evidence | WBPaper00000503 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (16) | |||||||||
| Method | Substitution_allele |
