WormBase Tree Display for Variation: WBVar00143964
expand all nodes | collapse all nodes | view schema
WBVar00143964 | Evidence | Paper_evidence | WBPaper00027360 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1387 | |||||||
Other_name | CE40504:p.Gln892Ter | ||||||||
F23B2.4.1:c.2674C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.9138243G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F23B2 | |||||
Flanking_sequences | cttctgagtcagcaatatttggatcgaagc | aaactgaagagaacttgacacttctgaata | |||||||
Mapping_target | F23B2 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004318 | ||||||||
WBStrain00006213 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000906 | |||||||
Transcript | F23B2.4.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F23B2.4.1:c.2674C>T | ||||||||
HGVSp | CE40504:p.Gln892Ter | ||||||||
cDNA_position | 2689 | ||||||||
CDS_position | 2674 | ||||||||
Protein_position | 892 | ||||||||
Exon_number | 16/21 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | IV | 4.05367 | ||||||
Mapping_data | In_2_point | 429 | |||||||
430 | |||||||||
In_multi_point | 3239 | ||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | |||||
WBPaper00000504 | |||||||||
WBPaper00000503 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Will not form Dauers on starved plates but will form Dauers in liquid culture. | Paper_evidence | WBPaper00000503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
defective dauer formation | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000150 | Paper_evidence | WBPaper00000503 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000247 | Paper_evidence | WBPaper00000503 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0/30 L2 larva, 1/30 adults move to within 1 cm of the center of a 50mM Na+ gradient in an orientation assay. Whereas 25/28 L2 N2 larva and 28/30 N2 adults move to within 1 cm of the center in the same assay. | Paper_evidence | WBPaper00000503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00000503 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000251 | Paper_evidence | WBPaper00000552 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Lacks detectable levels of octopamine. | Paper_evidence | WBPaper00000552 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
octopamine deficient | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005315 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000503 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00000503 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000256 | Paper_evidence | WBPaper00000316 | |||||||
WBPaper00000503 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Amphidial neurons are packed with electron dense material where cilia normally reside. Processes are enlarged, irregular and fail to reach their normal length. Other head sensilla are normal. | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Amphid neurons are foreshortened, misshapen, occasionally enlarged, often with irregular edges and are abnormal in arrangement, the channel itself is enlarged. | Paper_evidence | WBPaper00000503 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00000503 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Occasional FITC staining of ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal sensory anatomy especially amphidial neurons and sheath cells, cephalic neurons | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005394 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006754 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006920 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000615 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Amphid and mechanosensory cilia are irregularly shaped and abnormal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000662 | Paper_evidence | WBPaper00000503 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants do not disperse evenly over the bacterial lawn. | Paper_evidence | WBPaper00000503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00000503 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal osmotic avoidance | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000503 | |||||||
WBPaper00000932 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 0; no detected matings. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males impotent | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001040 | Paper_evidence | WBPaper00000316 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000316 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males do no mate successfully. | Paper_evidence | WBPaper00000316 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001434 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal chemotaxis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000503 | |||||||
WBPaper00000932 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Basal bodies are occasionally absent, neurons are sometimes enlarged and contain vesicular or granular material and occasional dense core assemblies. | Paper_evidence | WBPaper00000503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Occasional FITC staining of CEP. | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Occasional FITC staining of ADE and PDE. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001655 | Paper_evidence | WBPaper00026674 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00026674 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | |||||||
WBPaper00000932 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Weak frequent FITC staining of ADF and ADL but not other amphids or phasmids. | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Dyf (FITC uptake defective) | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002087 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000398 | Paper_evidence | WBPaper00000503 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (16) | |||||||||
Method | Substitution_allele |