WormBase Tree Display for Variation: WBVar00143936
expand all nodes | collapse all nodes | view schema
| WBVar00143936 | Evidence | Paper_evidence | WBPaper00003888 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1348 | |||||||
| Other_name | CE18951:p.Gln160Ter | ||||||||
| T09A5.10.1:c.478C>T | |||||||||
| T09A5.10.2:c.478C>T | |||||||||
| HGVSg | CHROMOSOME_II:g.7861183C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T09A5 | |||||
| Flanking_sequences | tgggcatgtcttcggagagatgacgaagat | aggaagcatccagtggcttcaggactccga | |||||||
| Mapping_target | T09A5 | ||||||||
| Type_of_mutation | Substitution | c | t | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004404 | ||||||||
| WBStrain00034590 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002994 | |||||||
| Transcript | T09A5.10.2 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | T09A5.10.2:c.478C>T | ||||||||
| HGVSp | CE18951:p.Gln160Ter | ||||||||
| cDNA_position | 479 | ||||||||
| CDS_position | 478 | ||||||||
| Protein_position | 160 | ||||||||
| Exon_number | 3/8 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| T09A5.10.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | T09A5.10.1:c.478C>T | ||||||||
| HGVSp | CE18951:p.Gln160Ter | ||||||||
| cDNA_position | 564 | ||||||||
| CDS_position | 478 | ||||||||
| Protein_position | 160 | ||||||||
| Exon_number | 3/8 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Genetics | Interpolated_map_position | II | 0.586618 | ||||||
| Mapping_data | In_multi_point | 50 | |||||||
| 705 | |||||||||
| 711 | |||||||||
| In_pos_neg_data | 1359 | ||||||||
| 1391 | |||||||||
| 1465 | |||||||||
| 1473 | |||||||||
| 1480 | |||||||||
| 1484 | |||||||||
| 1497 | |||||||||
| 1505 | |||||||||
| 1509 | |||||||||
| Description | Phenotype (12) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000433 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | All postembryonic divisions fail from defective cytokinesis although DNA replication continues. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000517 | Paper_evidence | WBPaper00000008 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | The behavior of the mutant at hatching is also indistinguishable from that of the wild type. | Paper_evidence | WBPaper00000008 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00000008 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001028 | Paper_evidence | WBPaper00000008 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | The numbers and morphology of nuclei present at hatching in C. elegans appear the same in the wild-type animals and in the mutant. | Paper_evidence | WBPaper00000008 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00000008 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO_term | GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00000008 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00013668 | ||||||||
| WBPaper00015855 | |||||||||
| WBPaper00000008 | |||||||||
| WBPaper00015907 | |||||||||
| WBPaper00013666 | |||||||||
| Method | Substitution_allele |
