WormBase Tree Display for Variation: WBVar00143932

WBVar00143932 Evidence: Paper_evidence: WBPaper00005591
  Name: Public_name: e1342
    Other_name: W02D3.3.3:c.908_909delinsAA
      CE31080:p.Trp303Ter
      W02D3.3.1:c.908_909delinsAA
      W02D3.3.2:c.908_909delinsAA
    HGVSg: CHROMOSOME_I:g.6727021_6727022delinsAA
  Sequence_details: SMap: S_parent: Sequence: W02D3
    Flanking_sequences: ctgctcatccagttattcatgaatctgcat cattatactcatccagaaaatcaaaatata
    Mapping_target: W02D3
    Type_of_mutation: Substitution: gg rr Paper_evidence: WBPaper00005591
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004340
      WBStrain00004383
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00003170
    Transcript: W02D3.3.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: W02D3.3.1:c.908_909delinsAA
        HGVSp: CE31080:p.Trp303Ter
        cDNA_position: 911-912
        CDS_position: 908-909
        Protein_position: 303
        Exon_number: 7/9
        Codon_change: tGG/tAA
        Amino_acid_change: W/*
      W02D3.3.3 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: W02D3.3.3:c.908_909delinsAA
        HGVSp: CE31080:p.Trp303Ter
        cDNA_position: 984-985
        CDS_position: 908-909
        Protein_position: 303
        Exon_number: 8/10
        Codon_change: tGG/tAA
        Amino_acid_change: W/*
      W02D3.3.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: W02D3.3.2:c.908_909delinsAA
        HGVSp: CE31080:p.Trp303Ter
        cDNA_position: 991-992
        CDS_position: 908-909
        Protein_position: 303
        Exon_number: 8/10
        Codon_change: tGG/tAA
        Amino_acid_change: W/*
    Interactor: WBInteraction000519070
      WBInteraction000519086
      WBInteraction000519087
      WBInteraction000571508
      WBInteraction000571510
      WBInteraction000571511
      WBInteraction000571521
      WBInteraction000571563
  Genetics: Interpolated_map_position: I 1.29964
    Mapping_data: In_2_point: 29
      In_multi_point: 33
        420
        964
  Description: Phenotype: WBPhenotype:0000456 Paper_evidence: WBPaper00000502
        Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: touch insensitive Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00000502
          Curator_confirmed: WBPerson712
        Ease_of_scoring: ES2_Difficult_to_score: Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000646 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: lethargic Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00030928
        Curator_confirmed: WBPerson48753
        Remark: DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) Paper_evidence: WBPaper00030928
            Curator_confirmed: WBPerson48753
      WBPhenotype:0002592 Paper_evidence: WBPaper00030928
        Curator_confirmed: WBPerson48753
        Remark: DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) Paper_evidence: WBPaper00030928
            Curator_confirmed: WBPerson48753
      WBPhenotype:0002606 Paper_evidence: WBPaper00041673
        Curator_confirmed: WBPerson2987
        Remark: "To determine the nature of HBx-induced cell death, we introduced the PhspHBx transgenes into animals defective in ced-3, which encodes a caspase essential for apoptosis (21), or animals defectivein mec-6, which is important for necrosis (22). A strong loss-of-function (lf) mutation in ced-3(n2433) or mec-6(e1342) partially suppressed embryonic lethality caused by HBx overexpression (Fig. 1B), indicating that both apoptotic and necrotic cell death contributes to lethality of HBx transgenic embryos." Paper_evidence: WBPaper00041673
            Curator_confirmed: WBPerson2987
          Figure 2A Paper_evidence: WBPaper00041673
            Curator_confirmed: WBPerson2987
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00041673
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: [PhspHBx; Psur-5::SUR-5::GFP] Paper_evidence: WBPaper00041673
              Curator_confirmed: WBPerson2987
            smIs98 [Pmec-3::GFP; Pmec-7::HBx] Paper_evidence: WBPaper00041673
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00022049
    WBPaper00000502
    WBPaper00015299
    WBPaper00011707
    WBPaper00030928
    WBPaper00041673
  Remark: e1342 is either a W(303) to opal or W(303) to amber nonsense mutation. Paper_evidence: WBPaper00005591
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003170 Amber_UAG_or_Opal_UGA W(303) to stop Paper_evidence: WBPaper00005591
  Method: Substitution_allele