WormBase Tree Display for Variation: WBVar00143932
expand all nodes | collapse all nodes | view schema
WBVar00143932 | Evidence | Paper_evidence | WBPaper00005591 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1342 | |||||
Other_name | W02D3.3.3:c.908_909delinsAA | ||||||
CE31080:p.Trp303Ter | |||||||
W02D3.3.1:c.908_909delinsAA | |||||||
W02D3.3.2:c.908_909delinsAA | |||||||
HGVSg | CHROMOSOME_I:g.6727021_6727022delinsAA | ||||||
Sequence_details | SMap | S_parent | Sequence | W02D3 | |||
Flanking_sequences | ctgctcatccagttattcatgaatctgcat | cattatactcatccagaaaatcaaaatata | |||||
Mapping_target | W02D3 | ||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00005591 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004340 | ||||||
WBStrain00004383 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003170 | |||||
Transcript | W02D3.3.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | W02D3.3.1:c.908_909delinsAA | ||||||
HGVSp | CE31080:p.Trp303Ter | ||||||
cDNA_position | 911-912 | ||||||
CDS_position | 908-909 | ||||||
Protein_position | 303 | ||||||
Exon_number | 7/9 | ||||||
Codon_change | tGG/tAA | ||||||
Amino_acid_change | W/* | ||||||
W02D3.3.3 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | W02D3.3.3:c.908_909delinsAA | ||||||
HGVSp | CE31080:p.Trp303Ter | ||||||
cDNA_position | 984-985 | ||||||
CDS_position | 908-909 | ||||||
Protein_position | 303 | ||||||
Exon_number | 8/10 | ||||||
Codon_change | tGG/tAA | ||||||
Amino_acid_change | W/* | ||||||
W02D3.3.2 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | W02D3.3.2:c.908_909delinsAA | ||||||
HGVSp | CE31080:p.Trp303Ter | ||||||
cDNA_position | 991-992 | ||||||
CDS_position | 908-909 | ||||||
Protein_position | 303 | ||||||
Exon_number | 8/10 | ||||||
Codon_change | tGG/tAA | ||||||
Amino_acid_change | W/* | ||||||
Interactor | WBInteraction000519070 | ||||||
WBInteraction000519086 | |||||||
WBInteraction000519087 | |||||||
WBInteraction000571508 | |||||||
WBInteraction000571510 | |||||||
WBInteraction000571511 | |||||||
WBInteraction000571521 | |||||||
WBInteraction000571563 | |||||||
Genetics | Interpolated_map_position | I | 1.29964 | ||||
Mapping_data | In_2_point | 29 | |||||
In_multi_point | 33 | ||||||
420 | |||||||
964 | |||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||
Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||
Remark | touch insensitive | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00000502 | |||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | lethargic | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00030928 | |||||
Curator_confirmed | WBPerson48753 | ||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||
Curator_confirmed | WBPerson48753 | ||||||
WBPhenotype:0002592 | Paper_evidence | WBPaper00030928 | |||||
Curator_confirmed | WBPerson48753 | ||||||
Remark | DAF-16::GFP nuclear accumulation does not occur as a result of 100G gravitational force as in control worms (Figure 7a) | Paper_evidence | WBPaper00030928 | ||||
Curator_confirmed | WBPerson48753 | ||||||
WBPhenotype:0002606 | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | "To determine the nature of HBx-induced cell death, we introduced the PhspHBx transgenes into animals defective in ced-3, which encodes a caspase essential for apoptosis (21), or animals defectivein mec-6, which is important for necrosis (22). A strong loss-of-function (lf) mutation in ced-3(n2433) or mec-6(e1342) partially suppressed embryonic lethality caused by HBx overexpression (Fig. 1B), indicating that both apoptotic and necrotic cell death contributes to lethality of HBx transgenic embryos." | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Figure 2A | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Phenotype_assay | Genotype (2) | ||||||
Reference | WBPaper00022049 | ||||||
WBPaper00000502 | |||||||
WBPaper00015299 | |||||||
WBPaper00011707 | |||||||
WBPaper00030928 | |||||||
WBPaper00041673 | |||||||
Remark | e1342 is either a W(303) to opal or W(303) to amber nonsense mutation. | Paper_evidence | WBPaper00005591 | ||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003170 Amber_UAG_or_Opal_UGA W(303) to stop | Paper_evidence | WBPaper00005591 | |||||
Method | Substitution_allele |