WormBase Tree Display for Variation: WBVar00143911
expand all nodes | collapse all nodes | view schema
| WBVar00143911 | Evidence | Paper_evidence | WBPaper00002741 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1313 | |||||||
| Other_name | CE26435:p.Trp73Ter | ||||||||
| F38G1.2.2:c.218G>A | |||||||||
| F38G1.2.1:c.218G>A | |||||||||
| HGVSg | CHROMOSOME_X:g.490824G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F38G1 | |||||
| Flanking_sequences | ttgtagccgattggaatgtggttggagaat | ggatggaaagtttcggttacaacatgcaca | |||||||
| Mapping_target | F38G1 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002741 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004296 | ||||||||
| WBStrain00007582 | |||||||||
| WBStrain00026853 | |||||||||
| WBStrain00026868 | |||||||||
| WBStrain00027058 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001185 | |||||||
| Transcript | F38G1.2.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F38G1.2.1:c.218G>A | ||||||||
| HGVSp | CE26435:p.Trp73Ter | ||||||||
| cDNA_position | 281 | ||||||||
| CDS_position | 218 | ||||||||
| Protein_position | 73 | ||||||||
| Exon_number | 5/8 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| F38G1.2.2 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F38G1.2.2:c.218G>A | ||||||||
| HGVSp | CE26435:p.Trp73Ter | ||||||||
| cDNA_position | 238 | ||||||||
| CDS_position | 218 | ||||||||
| Protein_position | 73 | ||||||||
| Exon_number | 4/7 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000519127 | ||||||||
| WBInteraction000519835 | |||||||||
| WBInteraction000535556 | |||||||||
| WBInteraction000538540 | |||||||||
| WBInteraction000538544 | |||||||||
| WBInteraction000538551 | |||||||||
| WBInteraction000538555 | |||||||||
| Genetics | Interpolated_map_position | X | -19.7039 | ||||||
| Mapping_data | In_2_point | 4453 | |||||||
| 6176 | |||||||||
| In_multi_point (11) | |||||||||
| Description | Phenotype (21) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 3 | Paper_evidence | WBPaper00005809 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "In contrast to the results with an unc-5 hypomorphic allele, the frequency of DTC migration defects of an unc-5 null allele was not significantly increased by any of the mutations in genes encoding growth factor-like molecules that we examined (Table 3)." | Paper_evidence | WBPaper00005809 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001336 | Paper_evidence | WBPaper00000635 | |||||||
| Curator_confirmed | WBPerson48 | ||||||||
| Phenotype_assay | Treatment | As described in Hodgkin, Horvitz, and Brenner (1979), six L4 males and six L4 dpy-11 hermaphrodites incubated for 24 hours, males removed, and hermaphrodites transferred to fresh dishes each day. Cross-progeny are counted. | Paper_evidence | WBPaper00000635 | |||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "No allele of egl-17, egl-15 or any other downstream FGF component other than sem-5 had any effect on orientation as single mutants (Table 1), which is probably due to the involvement of sem-5 in one of the other pathways controlling vulval orientation as well as its role in the FGF pathway." | Paper_evidence | WBPaper00044058 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00043908 | ||||||||
| WBPaper00032446 | |||||||||
| WBPaper00000635 | |||||||||
| WBPaper00005809 | |||||||||
| WBPaper00013863 | |||||||||
| WBPaper00013708 | |||||||||
| WBPaper00002741 | |||||||||
| WBPaper00014797 | |||||||||
| WBPaper00044058 | |||||||||
| Method | Substitution_allele |
