WormBase Tree Display for Variation: WBVar00143753
expand all nodes | collapse all nodes | view schema
WBVar00143753 | Evidence | Paper_evidence | WBPaper00003844 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1112 | |||||||
Other_name | B0432.5b.1:c.631C>T | ||||||||
CE37742:p.Gln211Ter | |||||||||
B0432.5c.1:c.826C>T | |||||||||
B0432.5a.1:c.841C>T | |||||||||
Y43H11AL.3a.2:c.-13+3945G>A | |||||||||
CE45548:p.Gln276Ter | |||||||||
CE29946:p.Gln281Ter | |||||||||
HGVSg | CHROMOSOME_II:g.259619C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0432 | |||||
Flanking_sequences | gcggtatatcggcaaaatttgaaaattctc | aagaggagaaggttttgacagcggatagga | |||||||
Mapping_target | B0432 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004246 | ||||||||
WBStrain00034688 | |||||||||
WBStrain00055863 | |||||||||
WBStrain00055864 | |||||||||
WBStrain00055865 | |||||||||
Laboratory | CB | ||||||||
IV | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004166 | |||||||
WBGene00000296 | |||||||||
Transcript | Y43H11AL.3a.2 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | Y43H11AL.3a.2:c.-13+3945G>A | ||||||||
Intron_number | 1/28 | ||||||||
B0432.5c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0432.5c.1:c.826C>T | ||||||||
HGVSp | CE45548:p.Gln276Ter | ||||||||
cDNA_position | 910 | ||||||||
CDS_position | 826 | ||||||||
Protein_position | 276 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
B0432.5a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0432.5a.1:c.841C>T | ||||||||
HGVSp | CE29946:p.Gln281Ter | ||||||||
cDNA_position | 841 | ||||||||
CDS_position | 841 | ||||||||
Protein_position | 281 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
B0432.5b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0432.5b.1:c.631C>T | ||||||||
HGVSp | CE37742:p.Gln211Ter | ||||||||
cDNA_position | 1547 | ||||||||
CDS_position | 631 | ||||||||
Protein_position | 211 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | II | -15.661 | ||||||
Mapping_data | In_2_point | 34 | |||||||
797 | |||||||||
In_multi_point | 45 | ||||||||
273 | |||||||||
Description | Phenotype (35) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Remark | Fig.1 (lifespan extension upon reserpine treatment, not different from wild type) | Paper_evidence | WBPaper00040570 | ||||||
Curator_confirmed | WBPerson8126 | ||||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00040570 | |||||
Curator_confirmed | WBPerson8126 | ||||||||
WBPhenotype:0000147 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Fasted mutants exhibited a wild type starvation response and decreased strongly the time they spent roaming when they reencountered food | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000222 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | serotonin normal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000227 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | no defect in male turning behavior | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000238 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Dopamine deficient cat-2 mutants did not have significant roaming defects | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Serotonin-IR (immunoreactivity) is WT. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000556 | Paper_evidence | WBPaper00006375 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ARS frequency of high-angled turns in the presence of exogenous dopamine is wild type as is the adaptation to dopamine over 30 minutes. | Paper_evidence | WBPaper00006375 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000712 | Paper_evidence | WBPaper00036343 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No significant change in germ cell death in cat-2 mutants compared to wild-type worms after IR | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Assayed by EM examination, vesicles and processes of the ventral ganglion are not different from WT. | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Clozapine-induced increases in egg laying was present. | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00044757 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 2A | Paper_evidence | WBPaper00044757 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001326 | Paper_evidence | WBPaper00036343 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No significant change in germ cell death in cat-2 mutants compared to wild-type worms after IR | Paper_evidence | WBPaper00036343 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited wild-type chemotaxis to NaCl. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:670 | |||||||
DOID:809 | |||||||||
DOID:14330 | |||||||||
DOID:0050742 | |||||||||
Models_disease_in_annotation | WBDOannot00000689 | ||||||||
WBDOannot00000690 | |||||||||
WBDOannot00000691 | |||||||||
WBDOannot00000969 | |||||||||
Reference (35) | |||||||||
Method | Substitution_allele |