WormBase Tree Display for Variation: WBVar00143714

WBVar00143714 Name: Public_name: e1062
    Other_name: F14F3.1a.1:c.445C>T
      F14F3.1a.2:c.445C>T
      CE24899:p.Arg149Ter
    HGVSg: CHROMOSOME_X:g.10511402C>T
  Sequence_details: SMap: S_parent: Sequence: F14F3
    Flanking_sequences: acaatgcaaacagagctttacgatagaatt gaatagttgataactttccgtaagtttcaa
    Mapping_target: F14F3
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00024640
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004234
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006870
    Transcript: F14F3.1a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F14F3.1a.1:c.445C>T
        HGVSp: CE24899:p.Arg149Ter
        cDNA_position: 747
        CDS_position: 445
        Protein_position: 149
        Exon_number: 7/14
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      F14F3.1a.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F14F3.1a.2:c.445C>T
        HGVSp: CE24899:p.Arg149Ter
        cDNA_position: 537
        CDS_position: 445
        Protein_position: 149
        Exon_number: 6/13
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00024640
  Genetics: Interpolated_map_position: X 2.22424
  Description: Phenotype: WBPhenotype:0000071 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Mutants have grossly deformed heads. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
      WBPhenotype:0000247 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Mutants are 30% responsive to Na+ in a behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
      WBPhenotype:0000254 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Mutants behave like WT in a Cl- gradient selection assay; however they are 15% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
      WBPhenotype:0000256 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Relative positions of the amphidial nerve types a through l are often distorted with respect to one another; one or both amphidial complexes may rotated 180 about the longitudinal axis. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
      WBPhenotype:0000342 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: The bursa is deformed. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00000214
                Curator_confirmed: WBPerson712
      WBPhenotype:0000637 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
      WBPhenotype:0000863 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Mutant males are less potent than WT. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
      WBPhenotype:0001528 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Sheath and socket cells fail to form. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000073 Paper_evidence: WBPaper00000214
        Curator_confirmed: WBPerson712
        Remark: Hermaphrodite tail is not effected. Paper_evidence: WBPaper00000214
            Curator_confirmed: WBPerson712
  Reference: WBPaper00000214
    WBPaper00014314
  Method: Substitution_allele