WormBase Tree Display for Variation: WBVar00143698
expand all nodes | collapse all nodes | view schema
WBVar00143698 | Evidence | Paper_evidence | WBPaper00006290 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1036 | ||||||
Other_name | CE34375:p.Arg732Ter | |||||||
T22D2.1.1:c.2194C>T | ||||||||
HGVSg | CHROMOSOME_II:g.2448396C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T22D2 | ||||
Flanking_sequences | ataaaatttcctatttattctaggtggaac | gaaaccaagtcaccactgcatccaacacca | ||||||
Mapping_target | T22D2 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006290 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005348 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006882 | ||||||
Transcript | T22D2.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | T22D2.1.1:c.2194C>T | |||||||
HGVSp | CE34375:p.Arg732Ter | |||||||
cDNA_position | 2207 | |||||||
CDS_position | 2194 | |||||||
Protein_position | 732 | |||||||
Exon_number | 13/20 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Interactor | WBInteraction000051810 | |||||||
WBInteraction000051813 | ||||||||
WBInteraction000051815 | ||||||||
WBInteraction000051817 | ||||||||
WBInteraction000501310 | ||||||||
WBInteraction000503804 | ||||||||
WBInteraction000519202 | ||||||||
WBInteraction000558282 | ||||||||
Genetics | Interpolated_map_position | II | -13.7339 | |||||
Description | Phenotype (12) | |||||||
Phenotype_not_observed | WBPhenotype:0000220 | Paper_evidence | WBPaper00038447 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Vulval cell division is normal. | Paper_evidence | WBPaper00038447 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 17 | Paper_evidence | WBPaper00038447 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000510 | Paper_evidence | WBPaper00038447 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Vulval invagination is normal. | Paper_evidence | WBPaper00038447 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 17 | Paper_evidence | WBPaper00038447 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00038447 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Measurements of vulval height and width after reductions of VAB-19 and integrin function revealed no differences when compared with wild-type animals. | Paper_evidence | WBPaper00038447 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 17 | Paper_evidence | WBPaper00038447 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038447 | |||||||
WBPaper00006290 | ||||||||
WBPaper00032244 | ||||||||
Remark | Behave genetically null at 15C, hypomorph at higher than 15C | |||||||
Method | Substitution_allele |