WormBase Tree Display for Variation: WBVar00143686
expand all nodes | collapse all nodes | view schema
WBVar00143686 | Name | Public_name | e1022 | ||||
---|---|---|---|---|---|---|---|
Other_name | F14F3.1b.1:c.146-1G>A | ||||||
F14F3.1c.1:c.227-1G>A | |||||||
F14F3.1a.2:c.704-1G>A | |||||||
F14F3.1a.1:c.704-1G>A | |||||||
HGVSg | CHROMOSOME_X:g.10516559G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | |||
Flanking_sequences | ctcattattatattaaaatgtttactttca | aatttgaaaggactcattatccagatgttt | |||||
Mapping_target | F14F3 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024640 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006870 | |||||
Transcript | F14F3.1c.1 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1c.1:c.227-1G>A | ||||||
Intron_number | 3/7 | ||||||
F14F3.1a.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1a.1:c.704-1G>A | ||||||
Intron_number | 9/13 | ||||||
F14F3.1a.2 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1a.2:c.704-1G>A | ||||||
Intron_number | 8/12 | ||||||
F14F3.1b.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F14F3.1b.1:c.146-1G>A | ||||||
Intron_number | 2/5 | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00024640 | |||
Genetics | Interpolated_map_position | X | 2.22447 | ||||
Remark | The exon numbering in the paper refers to a combination of all isoforms. Exon 11 corresponds to exon 8 in F14F3.1a and exon 3 in F14F3.1b and F14F3.1c. | Paper_evidence | WBPaper00024640 | ||||
Method | Substitution_allele |