WormBase Tree Display for Variation: WBVar00143651
expand all nodes | collapse all nodes | view schema
WBVar00143651 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e976 | |||
Other_name | C09G5.2a.1:c.797+349C>T | ||||
C09G5.6.1:c.2647+1G>A | |||||
HGVSg | CHROMOSOME_II:g.10711801G>A | ||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | |
Flanking_sequences | attcgagagagcatggaggacaagttccag | tagaattgttatgcggaaattatcattaaa | |||
Mapping_target | C09G5 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051516 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00007488 | |||
WBGene00000251 | |||||
Transcript (2) | |||||
Genetics | Interpolated_map_position | II | 3.12418 | ||
Remark | Variation information submitted by WBPerson10095 on 2022-02-17_15:01:34 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||
alt_det = g to a mut_det = gt -> at | Person_evidence | WBPerson10095 | |||
Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |