WormBase Tree Display for Variation: WBVar00143622
expand all nodes | collapse all nodes | view schema
WBVar00143622 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e944 | |||
Other_name | C09G5.6.1:c.456C>G | ||||
CE35827:p.Tyr152Ter | |||||
C09G5.2a.1:c.797+2590G>C | |||||
HGVSg | CHROMOSOME_II:g.10709560C>G | ||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | |
Flanking_sequences | tgcacctcctccagctgcgacatccaccta | agaccaccacatggatcaaactatgacaat | |||
Mapping_target | C09G5 | ||||
Type_of_mutation | Substitution | c | g | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051515 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00007488 | |||
WBGene00000251 | |||||
Transcript | C09G5.2a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | C09G5.2a.1:c.797+2590G>C | ||||
Intron_number | 6/10 | ||||
C09G5.6.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | C09G5.6.1:c.456C>G | ||||
HGVSp | CE35827:p.Tyr152Ter | ||||
cDNA_position | 510 | ||||
CDS_position | 456 | ||||
Protein_position | 152 | ||||
Exon_number | 4/7 | ||||
Codon_change | taC/taG | ||||
Amino_acid_change | Y/* | ||||
Genetics | Interpolated_map_position | II | 3.12412 | ||
Remark | alt_det = c to g mut_det = Y152Amber | Person_evidence | WBPerson10095 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson10095 on 2022-02-17_14:53:31 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |