WormBase Tree Display for Variation: WBVar00143592
expand all nodes | collapse all nodes | view schema
WBVar00143592 | Name | Public_name | e912 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F59G1.4a.1:c.250-263_947-68del | ||||||||
HGVSg | CHROMOSOME_II:g.5896964_5902373del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F59G1 | |||||
Flanking_sequences | aggaaggaacaagtcgatcggaaaatttta | ttttcacactgggagctagttccaataaaa | |||||||
Mapping_target | F59G1 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004403 | ||||||||
WBStrain00006311 | |||||||||
WBStrain00026764 | |||||||||
WBStrain00026863 | |||||||||
WBStrain00027055 | |||||||||
WBStrain00027229 | |||||||||
WBStrain00027586 | |||||||||
WBStrain00040213 | |||||||||
WBStrain00040275 | |||||||||
WBStrain00051497 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002993 | |||||||
WBGene00198855 | |||||||||
WBGene00199631 | |||||||||
WBGene00197123 | |||||||||
WBGene00019128 | |||||||||
Transcript | F59G1.6 | ||||||||
F59G1.13 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
F59G1.10 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
F59G1.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F59G1.4a.1:c.250-263_947-68del | ||||||||
Intron_number | 4-10/14 | ||||||||
Exon_number | 5-10/15 | ||||||||
F59G1.12 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
Interactor (17) | |||||||||
Isolation | Mutagen | ||||||||
Genetics | Interpolated_map_position | II | -0.855656 | ||||||
Mapping_data | In_2_point | 40 | |||||||
777 | |||||||||
4220 | |||||||||
In_multi_point (11) | |||||||||
In_pos_neg_data | 3708 | ||||||||
4223 | |||||||||
4224 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Severe Egl phenotype is also observed at 15 C | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 99 | 99 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000022 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000033 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Heterochronic defect | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000065 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000070 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000113 | Paper_evidence | WBPaper00056201 | |||||||
Curator_confirmed | WBPerson44293 | ||||||||
Remark | Figure 2a, e912 mutants have elevated SL1-LCE expression at later larval stages | Paper_evidence | WBPaper00056201 | ||||||
Curator_confirmed | WBPerson44293 | ||||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00026761 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Compared to the greater than 5-fold decrease in lin-14 and in lin-28 mRNA levels in wild-type worms, the levels of these mRNAs remained nearly constant from the L1- to the L2-stage in lin-4(e912) worms. | Paper_evidence | WBPaper00026761 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00031252 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In mixed stage lin-4(lf) animals, the enrichment of lin-14 in the AIN-2 IP result is significantly decreased compared to that in the WT background. In contrast, the enrichment of two other known miRNA targets, hbl-1 and lin-28, was similar | Paper_evidence | WBPaper00031252 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Person_evidence | WBPerson13152 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000164 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000201 | Paper_evidence | WBPaper00001002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult animals do not express adult-specific surface antigens. | Paper_evidence | WBPaper00001002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005755 | PATO:0000460 | Paper_evidence | WBPaper00001002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Adult animals (n=300) were incubated with 6ul total anti-adult antiserum cross-adsorbed with N2 L4's and 14ul 125I-protein A. | Paper_evidence | WBPaper00001002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000428 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Lacks adult cuticle. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000432 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult males lack copulatory structures. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000438 | Paper_evidence | WBPaper00001144 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Heterochronic, retarded adult hermaphrodites. Easy to score (ES3) in adult, very hard to score (ES1) in larvae. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals continue past the L4 molt to an L5 stage animal, not to an adult stage. | Paper_evidence | WBPaper00001144 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001144 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001144 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal movement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Penetrance | Complete | At 15 C, 4 percent of e912 hermaphrodites have recognizable vulval structures | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001228 | Paper_evidence | WBPaper00001144 | |||||||
Person_evidence | WBPerson13152 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not form adult lateral alae. | Paper_evidence | WBPaper00001144 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001144 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001144 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | male mating is completely abolished | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001687 | Paper_evidence | WBPaper00001002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult animals do not express adult-specific surface antigens. | Paper_evidence | WBPaper00001002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005755 | PATO:0000460 | Paper_evidence | WBPaper00001002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Adult animals (n=300) were incubated with 6ul total anti-adult antiserum cross-adsorbed with N2 L4's and 14ul 125I-protein A. | Paper_evidence | WBPaper00001002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001923 | Person_evidence | WBPerson13152 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002154 | Paper_evidence | WBPaper00032489 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Extracts from late L2 stage wild-type and lin-4(e912) mutant animals showed that experimentally validated target mRNAs, lin-14 and lin-28, were shifted into the polysomal fraction in the mutant. By contrast, polysome association of the control mRNAs act-1 and ama-1 and the let-7 target daf-12 is identical in lin-4(e912) and wild-type animals. | Paper_evidence | WBPaper00032489 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002157 | Paper_evidence | WBPaper00032489 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lin-14 and lin-28 transcript levels are increased in lin-4 mutants compared with wild-type animals, whereas daf-12, act-1 and ama-1 mRNA levels remain unchanged. | Paper_evidence | WBPaper00032489 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004001 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Hermaphrodite mating never successful (HME0) at 20C, rarely successful (HME1) at 15C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 20 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defecation cycle is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Pumping is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in dauer formation | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001233 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Cell number and nuclear staining is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Dyf | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005667 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005668 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007807 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007808 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DiO staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (35) | |||||||||
Method | Deletion_allele |