WormBase Tree Display for Variation: WBVar00143287
expand all nodes | collapse all nodes | view schema
WBVar00143287 | Evidence | Paper_evidence | WBPaper00005955 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e541 | |||||||
Other_name | Y37D8A.13.1:c.1669G>A | ||||||||
CE20217:p.Ala557Thr | |||||||||
HGVSg | CHROMOSOME_III:g.12884095C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y37D8A | |||||
Flanking_sequences | cagaagctttggggacgagaagctcgagtt | cggagccagtgtgctttgagcagaatacca | |||||||
Mapping_target | Y37D8A | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004180 | ||||||||
WBStrain00006386 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006804 | |||||||
Transcript | Y37D8A.13.1 (12) | ||||||||
Interactor | WBInteraction000518928 | ||||||||
Genetics | Interpolated_map_position | III | 19.2674 | ||||||
Mapping_data | In_2_point | 76 | |||||||
88 | |||||||||
4235 | |||||||||
In_multi_point | 63 | ||||||||
256 | |||||||||
1505 | |||||||||
1660 | |||||||||
3263 | |||||||||
In_pos_neg_data | 353 | ||||||||
5733 | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Strong kinker, especially in reverse. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000006 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 4 | 4 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons are posteriorly misdirected and never reach the nerve ring | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 15 | 15 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSNs fail to arrive at their final destination (between P5/6 and V4) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence (2) | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
WBPhenotype:0000880 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Variable defects in axonal elongation and fasciculation. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons show anterior blocks (axons enter the ventral cord normally but fail to complete the anterior growth towards the nerve ring) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 8 | 8 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001226 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Commissures sometimes on wrong side. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000641 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Fairly active. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00017709 | ||||||||
WBPaper00032446 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00001105 | |||||||||
WBPaper00016473 | |||||||||
WBPaper00019269 | |||||||||
WBPaper00011608 | |||||||||
Method | Substitution_allele |