WormBase Tree Display for Variation: WBVar00143229

WBVar00143229 Evidence: Paper_evidence: WBPaper00006355
  Name: Public_name: e459
    Other_name: Y59A8B.1a.1:c.3872G>A
      CE26205:p.Gly1291Glu
    HGVSg: CHROMOSOME_V:g.17940935C>T
  Sequence_details: SMap: S_parent: Sequence: Y59A8B
    Flanking_sequences: aaaacaatggagtacccctatttgccatcg agtaatggaaaatgcggcagaagcgctgca
    Mapping_target: Y59A8B
    Type_of_mutation: Substitution: g a
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001080
    Transcript: Y59A8B.1a.1 (12)
    Interactor: WBInteraction000052181
      WBInteraction000052433
  Genetics: Interpolated_map_position: V 13.3322
    Mapping_data: In_2_point: 170
      In_multi_point: 616
  Description: Phenotype: WBPhenotype:0000583 Paper_evidence: WBPaper00000666
          WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: XX animals are Dumpy; XO animals are not Dumpy. Paper_evidence: WBPaper00000666
            Curator_confirmed: WBPerson712
          XX animals are dumpy. Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00000666
          Curator_confirmed: WBPerson712
      WBPhenotype:0000718 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: As determined by the penetrance of the lin-14(n179) mutant phenotype, based on the [# mutant seam cell nuclei (undivided seam cell nuclei + nuclei that generated precocious alae)/ total # seam cell nuclei] animals after the L3 molt. Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Temperature: 24 Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Genotype: lin-14(n179) Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
      WBPhenotype:0001581 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: Animals have 26%(n=20) mutant seam cell nuclei, similar to XXX lin-14 animals (26% n=25) and less mutant than XX lin-14 animals (77% n=40). Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006913 PATO:0000460 Paper_evidence: WBPaper00001011
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000035 PATO:0000460 Paper_evidence: WBPaper00001011
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Temperature: 24 Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Genotype: lin-14(n179) Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
      WBPhenotype:0001582 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: XO lin-14(n179) males display significantly more lin-14 seam cell defects than lin-14 animals alone but similar to levels observed for lin-14/Df animals. Similar results were observed for e428/e459 (data not shown). Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00001011
                Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 20 Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Genotype: lin-14(n179) Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
      WBPhenotype:0001583 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: XXX and XXXX progeny are lethal. Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000520 Paper_evidence: WBPaper00000666
        Curator_confirmed: WBPerson712
        Remark: XO males are morphologically indistinguishable from wild type males. Paper_evidence: WBPaper00000666
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00000666
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00000666
                Curator_confirmed: WBPerson712
      WBPhenotype:0000648 Paper_evidence: WBPaper00000666
        Curator_confirmed: WBPerson712
        Remark: XO males are not mating deficient relative to wild type males in fertility measurements. Paper_evidence: WBPaper00000666
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00000666
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00000666
                Curator_confirmed: WBPerson712
  Reference: WBPaper00016180
    WBPaper00001011
    WBPaper00000666
    WBPaper00006355
    WBPaper00013900
  Method: Substitution_allele