WormBase Tree Display for Variation: WBVar00143178
expand all nodes | collapse all nodes | view schema
| WBVar00143178 | Evidence | Paper_evidence | WBPaper00003663 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e398 | |||||
| Other_name | F46A9.6.1:c.529C>T | ||||||
| CE08260:p.Gln177Ter | |||||||
| F46A9.6.2:c.529C>T | |||||||
| HGVSg | CHROMOSOME_I:g.9443139G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F46A9 | |||
| Flanking_sequences | gctctttcacttccacatttacatgctgca | aggcacttcaagcagcctatatgccagctt | |||||
| Mapping_target | F46A9 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003663 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004159 | ||||||
| WBStrain00022557 | |||||||
| WBStrain00022566 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003172 | |||||
| Transcript | F46A9.6.2 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F46A9.6.2:c.529C>T | ||||||
| HGVSp | CE08260:p.Gln177Ter | ||||||
| cDNA_position | 561 | ||||||
| CDS_position | 529 | ||||||
| Protein_position | 177 | ||||||
| Exon_number | 3/5 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| F46A9.6.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F46A9.6.1:c.529C>T | ||||||
| HGVSp | CE08260:p.Gln177Ter | ||||||
| cDNA_position | 561 | ||||||
| CDS_position | 529 | ||||||
| Protein_position | 177 | ||||||
| Exon_number | 3/6 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Interactor | WBInteraction000052179 | ||||||
| WBInteraction000052423 | |||||||
| WBInteraction000518886 | |||||||
| WBInteraction000538529 | |||||||
| WBInteraction000538530 | |||||||
| WBInteraction000538531 | |||||||
| Genetics | Interpolated_map_position | I | 3.76437 | ||||
| Mapping_data | In_2_point | 27 | |||||
| 5741 | |||||||
| In_multi_point (12) | |||||||
| In_pos_neg_data (13) | |||||||
| Description | Phenotype (15) | ||||||
| Phenotype_not_observed | WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | FITC does not stain ray sensilla. | Paper_evidence | WBPaper00000932 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000649 | Paper_evidence | WBPaper00003680 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000663 | Paper_evidence | WBPaper00000932 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals respond normally to concentrated NaCl. | Paper_evidence | WBPaper00000932 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001084 | Paper_evidence | WBPaper00000932 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals respond normally to a dilute gradient of NaCl. | Paper_evidence | WBPaper00000932 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0004004 | Paper_evidence | WBPaper00003680 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | males are not defective in response or vulva location | Paper_evidence | WBPaper00003680 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference (13) | |||||||
| Method | Substitution_allele |
