WormBase Tree Display for Variation: WBVar00143133

WBVar00143133 Evidence: Paper_evidence: WBPaper00004275
  Name: Public_name: e345
    Other_name: JC8.10b.1:c.547_839+1del
      JC8.10a.1:c.547_839+1del
      JC8.10d.1:c.547_839+1del
      JC8.10c.1:c.547_839+1del
    HGVSg: CHROMOSOME_IV:g.13269114_13269407del
  Sequence_details: SMap: S_parent: Sequence: Y67H2A
    Flanking_sequences: cataatttttcacacctatttttttccaga taattttactgtatttaagggatttttctt
    Mapping_target: Y67H2A
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00006181
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006763
    Transcript: JC8.10b.1 VEP_consequence: splice_donor_variant,coding_sequence_variant
        VEP_impact: HIGH
        HGVSc: JC8.10b.1:c.547_839+1del
        cDNA_position: 552-?
        CDS_position: 547-?
        Protein_position: 183-?
        Intron_number: 5/11
        Exon_number: 5/12
      JC8.10c.1 VEP_consequence: splice_donor_variant,coding_sequence_variant
        VEP_impact: HIGH
        HGVSc: JC8.10c.1:c.547_839+1del
        cDNA_position: 550-?
        CDS_position: 547-?
        Protein_position: 183-?
        Intron_number: 5/6
        Exon_number: 5/7
      JC8.10d.1 VEP_consequence: splice_donor_variant,coding_sequence_variant
        VEP_impact: HIGH
        HGVSc: JC8.10d.1:c.547_839+1del
        cDNA_position: 547-?
        CDS_position: 547-?
        Protein_position: 183-?
        Intron_number: 4/6
        Exon_number: 4/7
      JC8.10a.1 VEP_consequence: splice_donor_variant,coding_sequence_variant
        VEP_impact: HIGH
        HGVSc: JC8.10a.1:c.547_839+1del
        cDNA_position: 550-?
        CDS_position: 547-?
        Protein_position: 183-?
        Intron_number: 5/10
        Exon_number: 5/11
  Genetics: Interpolated_map_position: IV 8.5142
    Mapping_data: In_2_point: 21
        142
      In_multi_point (13)
      In_pos_neg_data: 976
        983
        3812
        8180
  Description: Phenotype: WBPhenotype:0000017 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000210 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000455 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000565 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
  Reference: WBPaper00004275
    WBPaper00013791
  Remark: The in-frame deletion removes the complete 4th exon. The flanking sequeneces are 30 bp to the left of S(183) and 30 bp to the right of R(280) Curator_confirmed: WBPerson1845
    e345 is an in-frame deletion of aa 183-280 Paper_evidence: WBPaper00004275
  Method: Deletion_allele