WormBase Tree Display for Variation: WBVar00143133
expand all nodes | collapse all nodes | view schema
WBVar00143133 | Evidence | Paper_evidence | WBPaper00004275 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e345 | |||||
Other_name | JC8.10b.1:c.547_839+1del | ||||||
JC8.10a.1:c.547_839+1del | |||||||
JC8.10d.1:c.547_839+1del | |||||||
JC8.10c.1:c.547_839+1del | |||||||
HGVSg | CHROMOSOME_IV:g.13269114_13269407del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y67H2A | |||
Flanking_sequences | cataatttttcacacctatttttttccaga | taattttactgtatttaagggatttttctt | |||||
Mapping_target | Y67H2A | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00006763 | |||||
Transcript | JC8.10b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | JC8.10b.1:c.547_839+1del | ||||||
cDNA_position | 552-? | ||||||
CDS_position | 547-? | ||||||
Protein_position | 183-? | ||||||
Intron_number | 5/11 | ||||||
Exon_number | 5/12 | ||||||
JC8.10c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | JC8.10c.1:c.547_839+1del | ||||||
cDNA_position | 550-? | ||||||
CDS_position | 547-? | ||||||
Protein_position | 183-? | ||||||
Intron_number | 5/6 | ||||||
Exon_number | 5/7 | ||||||
JC8.10d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | JC8.10d.1:c.547_839+1del | ||||||
cDNA_position | 547-? | ||||||
CDS_position | 547-? | ||||||
Protein_position | 183-? | ||||||
Intron_number | 4/6 | ||||||
Exon_number | 4/7 | ||||||
JC8.10a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | JC8.10a.1:c.547_839+1del | ||||||
cDNA_position | 550-? | ||||||
CDS_position | 547-? | ||||||
Protein_position | 183-? | ||||||
Intron_number | 5/10 | ||||||
Exon_number | 5/11 | ||||||
Genetics | Interpolated_map_position | IV | 8.5142 | ||||
Mapping_data | In_2_point | 21 | |||||
142 | |||||||
In_multi_point (13) | |||||||
In_pos_neg_data | 976 | ||||||
983 | |||||||
3812 | |||||||
8180 | |||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00004275 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000210 | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000455 | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00004275 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. | Paper_evidence | WBPaper00004275 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00004275 | ||||||
WBPaper00013791 | |||||||
Remark | The in-frame deletion removes the complete 4th exon. The flanking sequeneces are 30 bp to the left of S(183) and 30 bp to the right of R(280) | Curator_confirmed | WBPerson1845 | ||||
e345 is an in-frame deletion of aa 183-280 | Paper_evidence | WBPaper00004275 | |||||
Method | Deletion_allele |