WormBase Tree Display for Variation: WBVar00143048
expand all nodes | collapse all nodes | view schema
WBVar00143048 | Evidence | Paper_evidence | WBPaper00004453 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e228 | |||||||
Other_name | CE47887:p.Arg155Ter | ||||||||
Y50E8A.4c.1:c.463C>T | |||||||||
CE47829:p.Arg224Ter | |||||||||
Y50E8A.4a.1:c.670C>T | |||||||||
CE47979:p.Arg155Ter | |||||||||
Y50E8A.4b.1:c.463C>T | |||||||||
HGVSg | CHROMOSOME_V:g.14733125G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y50E8A | |||||
Flanking_sequences | gtcgcggaaggtggaatacgagtgaagctt | gactcgttgaaactgccggatttggagatc | |||||||
Mapping_target | Y50E8A | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004131 | ||||||||
WBStrain00022737 | |||||||||
WBStrain00022738 | |||||||||
WBStrain00022749 | |||||||||
WBStrain00029194 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006795 | |||||||
Transcript | Y50E8A.4b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50E8A.4b.1:c.463C>T | ||||||||
HGVSp | CE47887:p.Arg155Ter | ||||||||
cDNA_position | 496 | ||||||||
CDS_position | 463 | ||||||||
Protein_position | 155 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Y50E8A.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50E8A.4a.1:c.670C>T | ||||||||
HGVSp | CE47829:p.Arg224Ter | ||||||||
cDNA_position | 675 | ||||||||
CDS_position | 670 | ||||||||
Protein_position | 224 | ||||||||
Exon_number | 7/11 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Y50E8A.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y50E8A.4c.1:c.463C>T | ||||||||
HGVSp | CE47979:p.Arg155Ter | ||||||||
cDNA_position | 498 | ||||||||
CDS_position | 463 | ||||||||
Protein_position | 155 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Genetics | Interpolated_map_position | V | 6.74738 | ||||||
Mapping_data | In_2_point | 134 | |||||||
3128 | |||||||||
In_multi_point | 152 | ||||||||
669 | |||||||||
941 | |||||||||
945 | |||||||||
1161 | |||||||||
1163 | |||||||||
1165 | |||||||||
1914 | |||||||||
1915 | |||||||||
2016 | |||||||||
2054 | |||||||||
2265 | |||||||||
2266 | |||||||||
In_pos_neg_data | 4302 | ||||||||
6710 | |||||||||
Description | Phenotype | WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In the unc-61 mutant, 19% of the dorsal processes were too long or absent, and 5% of the subventral branches were truncated | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000352 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor backing | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000623 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | variable defects in neuroanatomy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000697 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | protrusive vulva | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001297 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | male tail very abnormal (rays absent, spicules reduced etc.) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004018 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | irregular waveform in forward movement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031671 | ||||||||
WBPaper00000031 | |||||||||
WBPaper00014204 | |||||||||
WBPaper00025382 | |||||||||
WBPaper00010843 | |||||||||
WBPaper00025381 | |||||||||
Method | Substitution_allele |