WormBase Tree Display for Variation: WBVar00143036

WBVar00143036 Evidence: Paper_evidence: WBPaper00006063
      WBPaper00005177
  Name: Public_name: e207
    Other_name: F46E10.9.1:c.10C>T
      CE20819:p.Arg4Ter
      F46E10.9.2:c.10C>T
    HGVSg: CHROMOSOME_V:g.6513336G>A
  Sequence_details: SMap: S_parent: Sequence: F46E10
    Flanking_sequences: ataaaacaagtcaattccagaatgctgctc gattgctcgccgtgctcggacttttcgccg
    Mapping_target: F46E10
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00006063
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004128
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001073
    Transcript: F46E10.9.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F46E10.9.2:c.10C>T
        HGVSp: CE20819:p.Arg4Ter
        cDNA_position: 164
        CDS_position: 10
        Protein_position: 4
        Exon_number: 3/9
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      F46E10.9.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F46E10.9.1:c.10C>T
        HGVSp: CE20819:p.Arg4Ter
        cDNA_position: 11
        CDS_position: 10
        Protein_position: 4
        Exon_number: 2/8
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
  Genetics: Interpolated_map_position: V -0.000884327
  Description: Phenotype: WBPhenotype:0000037 Paper_evidence: WBPaper00053410
        Curator_confirmed: WBPerson3569
        Remark: Short (Spherical) eggs, Figure 2 Paper_evidence: WBPaper00053410
            Curator_confirmed: WBPerson3569
      WBPhenotype:0000505 Paper_evidence: WBPaper00005177
        Curator_confirmed: WBPerson2987
        Remark: "Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." Paper_evidence: WBPaper00005177
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0048666 PATO:0000460 Paper_evidence: WBPaper00005177
                Curator_confirmed: WBPerson2987
      WBPhenotype:0000583 Paper_evidence: WBPaper00005177
        Curator_confirmed: WBPerson2987
        Remark: "Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." Paper_evidence: WBPaper00005177
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00005177
    WBPaper00006063
    WBPaper00053410
  Method: Substitution_allele