WormBase Tree Display for Variation: WBVar00143023
expand all nodes | collapse all nodes | view schema
WBVar00143023 | Evidence | Person_evidence | WBPerson499 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e189 | ||||||
Other_name | ZK637.8a.1:c.614+288G>A | |||||||
ZK637.8e.1:c.460-345G>A | ||||||||
ZK637.8f.1:c.460-1G>A | ||||||||
ZK637.8c.1:c.460-345G>A | ||||||||
ZK637.8b.1:c.460-1G>A | ||||||||
ZK637.8d.1:c.614+288G>A | ||||||||
HGVSg | CHROMOSOME_III:g.8906966G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | ||||
Flanking_sequences | taaaatctccttcactaacaca | gccgggactggagaaatgttgcca | ||||||
Mapping_target | ZK637 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (303) | ||||||||
Laboratory | CB | |||||||
OJ | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006768 | ||||||
Transcript | ZK637.8c.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8c.1:c.460-345G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8f.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK637.8f.1:c.460-1G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8e.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8e.1:c.460-345G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8d.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8d.1:c.614+288G>A | |||||||
Intron_number | 5/11 | |||||||
ZK637.8b.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK637.8b.1:c.460-1G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8a.1:c.614+288G>A | |||||||
Intron_number | 5/11 | |||||||
Interactor | WBInteraction000524785 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | -0.00184685 | |||||
Mapping_data | In_2_point (31) | |||||||
In_multi_point | 64 | |||||||
65 | ||||||||
66 | ||||||||
68 | ||||||||
70 | ||||||||
71 | ||||||||
76 | ||||||||
77 | ||||||||
78 | ||||||||
79 | ||||||||
80 | ||||||||
86 | ||||||||
87 | ||||||||
90 | ||||||||
93 | ||||||||
218 | ||||||||
219 | ||||||||
220 | ||||||||
315 | ||||||||
325 | ||||||||
326 | ||||||||
347 | ||||||||
356 | ||||||||
384 | ||||||||
385 | ||||||||
386 | ||||||||
387 | ||||||||
388 | ||||||||
404 | ||||||||
405 | ||||||||
406 | ||||||||
407 | ||||||||
408 | ||||||||
412 | ||||||||
428 | ||||||||
430 | ||||||||
488 | ||||||||
491 | ||||||||
492 | ||||||||
498 | ||||||||
502 | ||||||||
506 | ||||||||
513 | ||||||||
530 | ||||||||
580 | ||||||||
581 | ||||||||
584 | ||||||||
585 | ||||||||
588 | ||||||||
589 | ||||||||
611 | ||||||||
613 | ||||||||
629 | ||||||||
630 | ||||||||
642 | ||||||||
729 | ||||||||
746 | ||||||||
753 | ||||||||
758 | ||||||||
759 | ||||||||
761 | ||||||||
855 | ||||||||
863 | ||||||||
864 | ||||||||
868 | ||||||||
870 | ||||||||
887 | ||||||||
888 | ||||||||
889 | ||||||||
890 | ||||||||
892 | ||||||||
894 | ||||||||
895 | ||||||||
1080 | ||||||||
1085 | ||||||||
1086 | ||||||||
1112 | ||||||||
1255 | ||||||||
1357 | ||||||||
1363 | ||||||||
1364 | ||||||||
1401 | ||||||||
1402 | ||||||||
1412 | ||||||||
1414 | ||||||||
1421 | ||||||||
1489 | ||||||||
1490 | ||||||||
1497 | ||||||||
1498 | ||||||||
1500 | ||||||||
1501 | ||||||||
1503 | ||||||||
1506 | ||||||||
1510 | ||||||||
1577 | ||||||||
1637 | ||||||||
1669 | ||||||||
1726 | ||||||||
1728 | ||||||||
1729 | ||||||||
1730 | ||||||||
1731 | ||||||||
1735 | ||||||||
1752 | ||||||||
1754 | ||||||||
1816 | ||||||||
1836 | ||||||||
1863 | ||||||||
2012 | ||||||||
2018 | ||||||||
2055 | ||||||||
2057 | ||||||||
2074 | ||||||||
2099 | ||||||||
2101 | ||||||||
2151 | ||||||||
2179 | ||||||||
2185 | ||||||||
2190 | ||||||||
2198 | ||||||||
2199 | ||||||||
2223 | ||||||||
2226 | ||||||||
2235 | ||||||||
2246 | ||||||||
2305 | ||||||||
2306 | ||||||||
2312 | ||||||||
2425 | ||||||||
2462 | ||||||||
2463 | ||||||||
2740 | ||||||||
2742 | ||||||||
2744 | ||||||||
2755 | ||||||||
2764 | ||||||||
2766 | ||||||||
3014 | ||||||||
3138 | ||||||||
3155 | ||||||||
3156 | ||||||||
3166 | ||||||||
3177 | ||||||||
3178 | ||||||||
3225 | ||||||||
3246 | ||||||||
3261 | ||||||||
3297 | ||||||||
3298 | ||||||||
3299 | ||||||||
3300 | ||||||||
3301 | ||||||||
3302 | ||||||||
3324 | ||||||||
3325 | ||||||||
3326 | ||||||||
3327 | ||||||||
3328 | ||||||||
3329 | ||||||||
3330 | ||||||||
3331 | ||||||||
3332 | ||||||||
3333 | ||||||||
3334 | ||||||||
3335 | ||||||||
3336 | ||||||||
3337 | ||||||||
3338 | ||||||||
3339 | ||||||||
3340 | ||||||||
In_pos_neg_data | 806 | |||||||
3726 | ||||||||
Description | Phenotype (26) | |||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (32) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |