WormBase Tree Display for Variation: WBVar00143023
expand all nodes | collapse all nodes | view schema
WBVar00143023 | Evidence | Person_evidence | WBPerson499 | ||
---|---|---|---|---|---|
Name | Public_name | e189 | |||
Other_name | ZK637.8a.1:c.614+288G>A | ||||
ZK637.8e.1:c.460-345G>A | |||||
ZK637.8f.1:c.460-1G>A | |||||
ZK637.8c.1:c.460-345G>A | |||||
ZK637.8b.1:c.460-1G>A | |||||
ZK637.8d.1:c.614+288G>A | |||||
HGVSg | CHROMOSOME_III:g.8906966G>A | ||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | |
Flanking_sequences | taaaatctccttcactaacaca | gccgggactggagaaatgttgcca | |||
Mapping_target | ZK637 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (303) | |||||
Laboratory | CB | ||||
OJ | |||||
Status | Live | ||||
Affects | Gene | WBGene00006768 | |||
Transcript | ZK637.8c.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8c.1:c.460-345G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8f.1 | VEP_consequence | splice_acceptor_variant | |||
VEP_impact | HIGH | ||||
HGVSc | ZK637.8f.1:c.460-1G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8e.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8e.1:c.460-345G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8d.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8d.1:c.614+288G>A | ||||
Intron_number | 5/11 | ||||
ZK637.8b.1 | VEP_consequence | splice_acceptor_variant | |||
VEP_impact | HIGH | ||||
HGVSc | ZK637.8b.1:c.460-1G>A | ||||
Intron_number | 4/11 | ||||
ZK637.8a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK637.8a.1:c.614+288G>A | ||||
Intron_number | 5/11 | ||||
Interactor | WBInteraction000524785 | ||||
Isolation | Mutagen | EMS | |||
Genetics | Interpolated_map_position | III | -0.00184685 | ||
Mapping_data | In_2_point (31) | ||||
In_multi_point | 64 | ||||
65 | |||||
66 | |||||
68 | |||||
70 | |||||
71 | |||||
76 | |||||
77 | |||||
78 | |||||
79 | |||||
80 | |||||
86 | |||||
87 | |||||
90 | |||||
93 | |||||
218 | |||||
219 | |||||
220 | |||||
315 | |||||
325 | |||||
326 | |||||
347 | |||||
356 | |||||
384 | |||||
385 | |||||
386 | |||||
387 | |||||
388 | |||||
404 | |||||
405 | |||||
406 | |||||
407 | |||||
408 | |||||
412 | |||||
428 | |||||
430 | |||||
488 | |||||
491 | |||||
492 | |||||
498 | |||||
502 | |||||
506 | |||||
513 | |||||
530 | |||||
580 | |||||
581 | |||||
584 | |||||
585 | |||||
588 | |||||
589 | |||||
611 | |||||
613 | |||||
629 | |||||
630 | |||||
642 | |||||
729 | |||||
746 | |||||
753 | |||||
758 | |||||
759 | |||||
761 | |||||
855 | |||||
863 | |||||
864 | |||||
868 | |||||
870 | |||||
887 | |||||
888 | |||||
889 | |||||
890 | |||||
892 | |||||
894 | |||||
895 | |||||
1080 | |||||
1085 | |||||
1086 | |||||
1112 | |||||
1255 | |||||
1357 | |||||
1363 | |||||
1364 | |||||
1401 | |||||
1402 | |||||
1412 | |||||
1414 | |||||
1421 | |||||
1489 | |||||
1490 | |||||
1497 | |||||
1498 | |||||
1500 | |||||
1501 | |||||
1503 | |||||
1506 | |||||
1510 | |||||
1577 | |||||
1637 | |||||
1669 | |||||
1726 | |||||
1728 | |||||
1729 | |||||
1730 | |||||
1731 | |||||
1735 | |||||
1752 | |||||
1754 | |||||
1816 | |||||
1836 | |||||
1863 | |||||
2012 | |||||
2018 | |||||
2055 | |||||
2057 | |||||
2074 | |||||
2099 | |||||
2101 | |||||
2151 | |||||
2179 | |||||
2185 | |||||
2190 | |||||
2198 | |||||
2199 | |||||
2223 | |||||
2226 | |||||
2235 | |||||
2246 | |||||
2305 | |||||
2306 | |||||
2312 | |||||
2425 | |||||
2462 | |||||
2463 | |||||
2740 | |||||
2742 | |||||
2744 | |||||
2755 | |||||
2764 | |||||
2766 | |||||
3014 | |||||
3138 | |||||
3155 | |||||
3156 | |||||
3166 | |||||
3177 | |||||
3178 | |||||
3225 | |||||
3246 | |||||
3261 | |||||
3297 | |||||
3298 | |||||
3299 | |||||
3300 | |||||
3301 | |||||
3302 | |||||
3324 | |||||
3325 | |||||
3326 | |||||
3327 | |||||
3328 | |||||
3329 | |||||
3330 | |||||
3331 | |||||
3332 | |||||
3333 | |||||
3334 | |||||
3335 | |||||
3336 | |||||
3337 | |||||
3338 | |||||
3339 | |||||
3340 | |||||
In_pos_neg_data | 806 | ||||
3726 | |||||
Description | Phenotype (26) | ||||
Phenotype_not_observed (2) | |||||
Reference (32) | |||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |