WormBase Tree Display for Variation: WBVar00142953
expand all nodes | collapse all nodes | view schema
WBVar00142953 | Evidence | Paper_evidence | WBPaper00001618 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46C8 | ||||
Flanking_sequences | gctggcccaccaggaactcgaggaccacag | gagaagttggacgtccaggacagactggtg | ||||||
Mapping_target | F46C8 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001618 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004095 | |||||||
WBStrain00023947 | ||||||||
WBStrain00026736 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001069 | ||||||
Transcript | F46C8.6.1 (12) | |||||||
Interactor | WBInteraction000052373 | |||||||
WBInteraction000519116 | ||||||||
WBInteraction000519123 | ||||||||
WBInteraction000537304 | ||||||||
WBInteraction000571286 | ||||||||
WBInteraction000571288 | ||||||||
WBInteraction000571291 | ||||||||
WBInteraction000571292 | ||||||||
WBInteraction000571572 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00001618 | ||||
Genetics | Interpolated_map_position | X | -1.6004 | |||||
Mapping_data | In_2_point (14) | |||||||
In_multi_point (28) | ||||||||
In_pos_neg_data (17) | ||||||||
Description | Phenotype (18) | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000645 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | non-roller | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | dpy-7(e88) did not affect the lipid depleted phenotype of daf-2(e1370);aak-2(ok524) double mutant dauers (Figure 2h) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Dauer larva were stained with Sudan Black to visualize lipid content | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | daf-2(e1370);aak-2(ok524) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | ||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:37 | ||||||
Models_disease_in_annotation | WBDOannot00001175 | |||||||
Reference (15) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |