WormBase Tree Display for Variation: WBVar00142953
expand all nodes | collapse all nodes | view schema
| WBVar00142953 | Evidence | Paper_evidence | WBPaper00001618 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e88 | |||||||
| Other_name | CE04580:p.Gly156Arg | ||||||||
| F46C8.6.1:c.466G>A | |||||||||
| HGVSg | CHROMOSOME_X:g.7537144C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F46C8 | |||||
| Flanking_sequences | gctggcccaccaggaactcgaggaccacag | gagaagttggacgtccaggacagactggtg | |||||||
| Mapping_target | F46C8 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001618 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004095 | ||||||||
| WBStrain00023947 | |||||||||
| WBStrain00026736 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001069 | |||||||
| Transcript | F46C8.6.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| SIFT | 0 | deleterious | |||||||
| PolyPhen | 1 | probably_damaging | |||||||
| HGVSc | F46C8.6.1:c.466G>A | ||||||||
| HGVSp | CE04580:p.Gly156Arg | ||||||||
| cDNA_position | 470 | ||||||||
| CDS_position | 466 | ||||||||
| Protein_position | 156 | ||||||||
| Exon_number | 3/4 | ||||||||
| Codon_change | Gga/Aga | ||||||||
| Amino_acid_change | G/R | ||||||||
| Interactor | WBInteraction000052373 | ||||||||
| WBInteraction000519116 | |||||||||
| WBInteraction000519123 | |||||||||
| WBInteraction000537304 | |||||||||
| WBInteraction000571286 | |||||||||
| WBInteraction000571288 | |||||||||
| WBInteraction000571291 | |||||||||
| WBInteraction000571292 | |||||||||
| WBInteraction000571572 | |||||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00001618 | |||||
| Genetics | Interpolated_map_position | X | -1.6004 | ||||||
| Mapping_data | In_2_point | 156 | |||||||
| 160 | |||||||||
| 179 | |||||||||
| 180 | |||||||||
| 263 | |||||||||
| 396 | |||||||||
| 399 | |||||||||
| 3644 | |||||||||
| 3653 | |||||||||
| 3656 | |||||||||
| 6056 | |||||||||
| 6057 | |||||||||
| 6063 | |||||||||
| 6120 | |||||||||
| In_multi_point | 170 | ||||||||
| 174 | |||||||||
| 175 | |||||||||
| 176 | |||||||||
| 182 | |||||||||
| 314 | |||||||||
| 359 | |||||||||
| 421 | |||||||||
| 423 | |||||||||
| 1318 | |||||||||
| 1331 | |||||||||
| 1340 | |||||||||
| 1343 | |||||||||
| 1344 | |||||||||
| 1345 | |||||||||
| 1347 | |||||||||
| 1348 | |||||||||
| 1349 | |||||||||
| 1350 | |||||||||
| 1351 | |||||||||
| 1352 | |||||||||
| 1538 | |||||||||
| 2214 | |||||||||
| 3124 | |||||||||
| 3126 | |||||||||
| 3128 | |||||||||
| 3245 | |||||||||
| 4794 | |||||||||
| In_pos_neg_data | 937 | ||||||||
| 1875 | |||||||||
| 1914 | |||||||||
| 1930 | |||||||||
| 1946 | |||||||||
| 1962 | |||||||||
| 1978 | |||||||||
| 1994 | |||||||||
| 2001 | |||||||||
| 2010 | |||||||||
| 2021 | |||||||||
| 2042 | |||||||||
| 3664 | |||||||||
| 5502 | |||||||||
| 7290 | |||||||||
| 7291 | |||||||||
| 7292 | |||||||||
| Description | Phenotype | WBPhenotype:0000067 | Paper_evidence | WBPaper00053771 | |||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | mRNA levels for the following stress-inducible genes were increased in the dpy-7(e88) mutant background - gpdh-1(osmotic), hmit-1.1(osmotic), gst-4 (detoxification), gst-10 (detoxification), gst-30 (detoxification) and nlp-29 (antimicrobial). | Paper_evidence | WBPaper00053771 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0000135 | Paper_evidence | WBPaper00057200 | |||||||
| WBPaper00053771 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson557 | |||||||||
| Remark | We used quantitative RT-qPCR to measure expression of stress response-related genes in dpy-7(e88) worms; mRNA levels of each potential stress response gene were normalized to rpl-2, which encodes a ribosomal protein. pgph-1, T23F2.4, and cyp-14A5 were significantly upregulated in dpy-7 mutants compared to N2 in the absence of environmental stress. | Paper_evidence | WBPaper00057200 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| mRNA levels for the following stress-inducible genes were increased in the dpy-7(e88) mutant background - gpdh-1(osmotic), hmit-1.1(osmotic), gst-4 (detoxification), gst-10 (detoxification), gst-30 (detoxification) and nlp-29 (antimicrobial). | Paper_evidence | WBPaper00053771 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Image | WBPicture0000014925 | Paper_evidence | WBPaper00057200 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000324 | Paper_evidence | WBPaper00032064 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mean length was 199.1 4.3um (n=25) compared to 252.9 3.1 um for wild type. As determined by high-resolution, lensless, optofluidic microscopy method (OFM)-based on-chip microscopy. | Paper_evidence | WBPaper00032064 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | |||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | ||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | |||||
| Curator_confirmed | WBPerson3900 | ||||||||
| WBPhenotype:0000462 | Paper_evidence | WBPaper00061220 | |||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Remark | Enhanced susceptibility to paraquat (Figure 3A) | Paper_evidence | WBPaper00061220 | ||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00061220 | |||||
| Curator_confirmed | WBPerson3900 | ||||||||
| WBPhenotype:0000542 | Paper_evidence | WBPaper00032064 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals were statistically wider than N2. Mean width was 12.1 0.1um (n=25) compared to 11.7 0.1 um for wild type. As determined by high-resolution, lensless, optofluidic microscopy method (OFM)-based on-chip microscopy. | Paper_evidence | WBPaper00032064 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
| WBPaper00005747 | |||||||||
| WBPaper00064435 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson712 | |||||||||
| WBPerson2987 | |||||||||
| WBPerson6532 | |||||||||
| Remark | dumpy | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Authors report "medium dpy" (Table 1) | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000645 | Paper_evidence | WBPaper00000031 | |||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0000948 | Paper_evidence | WBPaper00061220 | |||||||
| WBPaper00064435 | |||||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| WBPerson6532 | |||||||||
| Remark | Irregular indentations in the cuticle (Figure 2) | Paper_evidence | WBPaper00061220 | ||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001014 | Paper_evidence | WBPaper00061220 | |||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Remark | Enhanced resistance to Pseudomonas aeruginosa (Figure S4F) | Paper_evidence | WBPaper00061220 | ||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| WBPhenotype:0001236 | Paper_evidence | WBPaper00053771 | |||||||
| Curator_confirmed | WBPerson499 | ||||||||
| Remark | dpy-7(e88) induces expression of nlp-29p::GFP (Figure S4C) | Paper_evidence | WBPaper00053771 | ||||||
| Curator_confirmed | WBPerson499 | ||||||||
| Phenotype_assay | Genotype | frIs7 [nlp-29p::gfp, col-12p::DsRed] | Paper_evidence | WBPaper00053771 | |||||
| Curator_confirmed | WBPerson499 | ||||||||
| WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Authors report "missing or amorphous annuli" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001918 | Paper_evidence | WBPaper00061220 | |||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Remark | Enhanced susceptibility to ivermectin (Figure 3L) | Paper_evidence | WBPaper00061220 | ||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00061220 | |||||
| Curator_confirmed | WBPerson3900 | ||||||||
| WBPhenotype:0002539 | Paper_evidence | WBPaper00053771 | |||||||
| Curator_confirmed | WBPerson499 | ||||||||
| Remark | dpy-7(e88) induces expression of nlp-29p::GFP (Figure S4C) | Paper_evidence | WBPaper00053771 | ||||||
| Curator_confirmed | WBPerson499 | ||||||||
| Phenotype_assay | Genotype | frIs7 [nlp-29p::gfp, col-12p::DsRed] | Paper_evidence | WBPaper00053771 | |||||
| Curator_confirmed | WBPerson499 | ||||||||
| WBPhenotype:0002575 | Paper_evidence | WBPaper00064435 | |||||||
| Curator_confirmed | WBPerson6532 | ||||||||
| WBPhenotype:0002641 | Paper_evidence | WBPaper00061220 | |||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Remark | Cuticle permeable to Hoechst 33258 (Figure S1) | Paper_evidence | WBPaper00061220 | ||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000645 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | non-roller | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001182 | Paper_evidence | WBPaper00032396 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | dpy-7(e88) did not affect the lipid depleted phenotype of daf-2(e1370);aak-2(ok524) double mutant dauers (Figure 2h) | Paper_evidence | WBPaper00032396 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | Dauer larva were stained with Sudan Black to visualize lipid content | Paper_evidence | WBPaper00032396 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Genotype | daf-2(e1370);aak-2(ok524) | Paper_evidence | WBPaper00032396 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Disease_info | Models_disease | DOID:37 | |||||||
| Models_disease_in_annotation | WBDOannot00001175 | ||||||||
| Reference | WBPaper00015500 | ||||||||
| WBPaper00001328 | |||||||||
| WBPaper00000031 | |||||||||
| WBPaper00004883 | |||||||||
| WBPaper00005747 | |||||||||
| WBPaper00024920 | |||||||||
| WBPaper00032033 | |||||||||
| WBPaper00032064 | |||||||||
| WBPaper00032396 | |||||||||
| WBPaper00057200 | |||||||||
| WBPaper00061175 | |||||||||
| WBPaper00053771 | |||||||||
| WBPaper00061220 | |||||||||
| WBPaper00065341 | |||||||||
| WBPaper00064435 | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
