WormBase Tree Display for Variation: WBVar00142928

WBVar00142928 Name: Public_name: e41
    Other_name: F14F3.1a.1:c.360+1G>A
      F14F3.1a.2:c.360+1G>A
    HGVSg: CHROMOSOME_X:g.10511250G>A
  Sequence_details: SMap: S_parent: Sequence: F14F3
    Flanking_sequences: aatatctgcaacaacgaaacaataccaagc tgagtatttaacttgaatgtttgaaacttt
    Mapping_target: F14F3
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00002236
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006870
    Transcript: F14F3.1a.1 VEP_consequence: splice_donor_variant
        VEP_impact: HIGH
        HGVSc: F14F3.1a.1:c.360+1G>A
        Intron_number: 6/13
      F14F3.1a.2 VEP_consequence: splice_donor_variant
        VEP_impact: HIGH
        HGVSc: F14F3.1a.2:c.360+1G>A
        Intron_number: 5/12
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00002236
  Genetics: Interpolated_map_position: X 2.22424
    Mapping_data: In_multi_point: 3020
  Reference: WBPaper00014314
    WBPaper00021795
  Remark: The exon numbering in this paper refers to a combination of all isoforms. Exon 5 corresponds to exon 4 of isoform F14F3.1a Paper_evidence: WBPaper00024640
  Method: Substitution_allele