WormBase Tree Display for Variation: WBVar00142799
expand all nodes | collapse all nodes | view schema
| WBVar00142799 | Evidence | Paper_evidence | WBPaper00006352 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | dd5 | |||||||
| Other_name (28) | |||||||||
| HGVSg | CHROMOSOME_IV:g.13033544G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F49E11 | |||||
| Flanking_sequences | tatccattattgcctggagaggatgagaat | accagctggcacttatcattgaactactcg | |||||||
| Mapping_target | F49E11 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (22) | |||||||||
| Laboratory | TH | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003150 | |||||||
| Transcript (14) | |||||||||
| Interactor | WBInteraction000051984 | ||||||||
| WBInteraction000051985 | |||||||||
| WBInteraction000051986 | |||||||||
| WBInteraction000502680 | |||||||||
| WBInteraction000558303 | |||||||||
| WBInteraction000558304 | |||||||||
| WBInteraction000558305 | |||||||||
| WBInteraction000558306 | |||||||||
| WBInteraction000558307 | |||||||||
| WBInteraction000558308 | |||||||||
| Genetics | Interpolated_map_position | IV | 6.98611 | ||||||
| Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032438 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000351 | Paper_evidence | WBPaper00032438 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00033119 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | mbk-2 mutant embryos had no effect on the timing of MEL-26 expression | Paper_evidence | WBPaper00033119 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00033119 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00033119 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | MEL-26 antibody staining | Paper_evidence | WBPaper00033119 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00033119 | ||||||||
| WBPaper00032438 | |||||||||
| Method | Substitution_allele |
