WormBase Tree Display for Variation: WBVar00095116

WBVar00095116 Evidence: Paper_evidence: WBPaper00002585
  Name: Public_name: p678
    Other_name: CE27352:p.Gln82Ter
      ZC84.2.1:c.244C>T
    HGVSg: CHROMOSOME_III:g.9181987C>T
  Sequence_details: SMap: S_parent: Sequence: ZC84
    Flanking_sequences: aatgcagttcaaccagcggccaccggtggt agccggcatcttccgatggcggttcagcta
    Mapping_target: ZC84
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00002585
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00003905
      WBStrain00003907
      WBStrain00022726
      WBStrain00022727
      WBStrain00023534
      WBStrain00023536
      WBStrain00023537
      WBStrain00030785
    Laboratory: PR
    Status: Live
  Affects: Gene: WBGene00006526
    Transcript: ZC84.2.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZC84.2.1:c.244C>T
        HGVSp: CE27352:p.Gln82Ter
        cDNA_position: 248
        CDS_position: 244
        Protein_position: 82
        Exon_number: 4/12
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
    Interactor (13)
  Genetics: Interpolated_map_position: III 0.283998
  Description: Phenotype (33)
    Phenotype_not_observed: WBPhenotype:0000012 Paper_evidence: WBPaper00038115
        Curator_confirmed: WBPerson712
        Remark: Less than 5% dauer at either 15 or 25 deg C. Paper_evidence: WBPaper00038115
            Curator_confirmed: WBPerson712
      WBPhenotype:0001285 Paper_evidence: WBPaper00045598
        Curator_confirmed: WBPerson712
        Remark: Mutants show a significant reduction in pumping following exposure to 10% CO2, similar to the reduction observed in wild-type (N2) animals Paper_evidence: WBPaper00045598
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00003023 Paper_evidence: WBPaper00045598
              Curator_confirmed: WBPerson712
      WBPhenotype:0001474 Paper_evidence: WBPaper00041842
        Curator_confirmed: WBPerson2987
        Remark: The tax-4(p678) mutation did not affect animals' chemotaxis response to pyrazine (Figure S1D) Paper_evidence: WBPaper00041842
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00005360 Paper_evidence: WBPaper00041842
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001616 Paper_evidence: WBPaper00024698
        Curator_confirmed: WBPerson712
        Remark: Trimethadione significantly extended life-span of mutant animals (N=52)(1 ind.exp.), as observed for WT animals. Paper_evidence: WBPaper00024698
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Lifespan analysis was performed on animals exposed to 4 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. Paper_evidence: WBPaper00024698
              Curator_confirmed: WBPerson712
          Temperature: 20C Paper_evidence: WBPaper00024698
              Curator_confirmed: WBPerson712
      WBPhenotype:0001660 Paper_evidence: WBPaper00006052
        Curator_confirmed: WBPerson2021
        Remark: No disruption of ASE asymmetry (as seen with lim-6 reporters) Paper_evidence: WBPaper00006052
            Curator_confirmed: WBPerson2021
        Variation_effect: Null: Paper_evidence: WBPaper00006052
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: otIs114, otIs6 Paper_evidence: WBPaper00006052
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001690 Paper_evidence: WBPaper00028386
        Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown synchronously from hatching to L2 on NGM plates containing crude pheromone extract. Paper_evidence: WBPaper00028386
              Curator_confirmed: WBPerson712
      WBPhenotype:0001736 Paper_evidence: WBPaper00031959
        Curator_confirmed: WBPerson712
        Remark: Animals showed no defect in acetate chemotaxis in water soluble assays when compared to che-1(p679) positive control animals. Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031959
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00005057 Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: For the water soluble chemotaxis assay, radial gradients of NaAc were established by diffusion in the agar. Paper_evidence: WBPaper00031959
              Curator_confirmed: WBPerson712
      WBPhenotype:0001897 Paper_evidence: WBPaper00032087
        Curator_confirmed: WBPerson2021
        Remark: Loss-of-function mutations in the TAX-4 CNG channels do not affect the overall locomotion response to short wavelength light Paper_evidence: WBPaper00032087
            Curator_confirmed: WBPerson2021
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032087
            Curator_confirmed: WBPerson2021
  Reference (37)
  Remark: Corrected from pr678 appeared In 2002 European Worm Meeting abstract Person_evidence: WBPerson712
  Method: Substitution_allele